. What is wobble base-pairing? According to Wobble's rule, one tRNA is sufficient to decode the three codons of threonine (ACU, ACC, and ACA). Explain the phenomenon?
Q: What type of bonding interaction causes stem-loops to form?
A: Stem loop is also known as hairpin loop structure. It is an intramolecular base pairing that…
Q: Discuss the significance of modified bases within tRNA molecules.
A: There are four nucleotide bases present in DNA such as Adenine (A), Thymine (T), Guanine (G) and…
Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop
A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…
Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are)…
A: A codon refers to a specific sequence of deoxy ribonucleotide (DNA) or ribonucleic acid (RNA), which…
Q: The code word GGG cannot be deciphered in the same way as can UUU, CCC, and AAA, because poly(G)…
A: RNA silencing is the mechanism by which gene expression is negatively regulated by non-coding RNA…
Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Arginine is coded by six mRNA codons.
Q: Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and…
A: Given Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by…
Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…
A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…
Q: Does base stacking play any role in stability of RNA (single-stranded)? Explain please!
A: Introduction Deoxyribonucleic acid (DNA) is one of the important biomolecules. It is a long…
Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…
A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…
Q: 1. Here is the amino acid sequence of part of a hypothetical gene you want to clone:…
A: The degeneracy of the genetic code explains that most of the amino acids defined by more than one…
Q: Transfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides.…
A: Proteins within the human body are made up of a small chain of building blocks, which are termed…
Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…
A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…
Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…
A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…
Q: A protein domain that recognizes 5-methylcytosine in the context of double-stranded DNA has been…
A: SET and RING-finger-associated (SRA) domain is involved in establishment and maintenance of DNA…
Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…
A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…
Q: Which anticodon would you predict for a tRNA speciescarrying isoleucine? Is there more than one…
A: A codon can be defined as the three-nucleotide sequence present on the DNA or RNA which codes for…
Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…
A: tRNA It is a leaf like structure can has anticodon sequence at one end and attached amino acid on…
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…
Q: List all single base substitutions that would change a codon for Leu to a nonsense codon. For each,…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…
Q: Explain the mechanism of trinucleotide repeat expansion.
A: Introduction: A trinucleotide repeat expansion is type of DNA mutation. In which, the trinucleotide…
Q: (d) Let's suppose (I'm not saying they are; you figured that out in the question above) that the…
A: The eukaryotic genes are interrupted. The pre-mRNA contains exons and introns. The introns are…
Q: Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or…
A: The attachment of the amino acid to the cognate tRNA is caused by the aminoacyl-tRNA synthetase.…
Q: The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G',…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…
A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…
Q: b) How does accuracy of aminoacylation during tRNA charging regulated to ensure fidelity of genetic…
A: Answer. The fidelity of protein synthesis depends on the accuracy of the two mechanisms: The linking…
Q: a) Complete the table below. Assume that reading is from left to right and that the columns…
A: In molecular biology central dogma is the mechanism which takes place from the DNA(hereditary unit…
Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…
A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…
Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…
A: Genetic codon It is a group of three nucleotide that code for amino acids. They are total 64…
Q: Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA…
A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…
Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…
A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…
Q: Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a…
A: The DNA is transcribed into to an RNA by the process of transcription. Following the transcription…
Q: Although aminoacyl-tRNA synhtetases make few errors, occasionally an error. How can these error be…
A: The translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: tRNAs contain 4 arms, each characterized by the presence certain modified bases or speciic…
A: tRNA have 4 major arms and 1 variable arm. The 4 major arms of tRNA are ; D arm Anticodon arm TψC…
Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…
A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…
Q: For the case n = 5, the equilibrium constant for this reaction, Keg, is 5-10³ and for n= 6 Keg =…
A: Thermodynamics in biochemistry is the quantitative study of the change in energy which occurs in or…
Q: An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single…
A: Genetic code is read in the form of triplets.so first we will convert these to 3 codes and then…
Q: Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon…
A: tRNA is transfer RNA which is an adaptor molecule and assists in formation of peptide chain during…
Q: 3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs…
A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…
Q: E. coli oriC is rich in A · T base pairs. Why is this advantageous?
A: E.coli is a gram-negative bacteria that is found in the lower part of the intestine if warm blood…
Q: If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it…
A: An anticodon is a trinucleotide sequence that is complementary to that of a corresponding codon in…
Base pair is defined as two complementary nitrogenous that are connected by hydrogen bonds. Base pairs are found in double stranded DNA and RNA, where the bonds between them connect the two strands, making the double stranded structure possible.
Step by step
Solved in 2 steps
- For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?why a literature sequence for Mpro includes additional 18 bases on the C-term that can not be found in the nature protein. what is the purpose of these bases?
- Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might wobble tend to accelerate the rate of translation?The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methionine C. SerineHow many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain
- Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a mechanism for distinguishing a start codon from a methionine codon. What is the eukaryotic version of this mechanism?Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′. What type(s) of base modification to this tRNA would allow it to also recognize 5′–AAA–3′?Transfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides. What is the purpose of the rest of the tRNA molecule?
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminusa) Identify the current stage of the translation process shown in Figure 1 and name the anticodon sequence in tRNAb) State TWO immediate, main consequences when a stop codon reaches the E site.If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it could contain? Be specific about the 5′ and 3′ ends.