Answered: A tRNA's anticodon binds to the RNA…

Science

Biology

A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's anticodon?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Related questions

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: Which of the following statements are true? O Each stop codon also codes for an amino acid O Each…

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…

Q: Which of the following is true regarding the tRNA structure? The anticodon is found at the 5′ end…

A: The anticodon is found at the 51 end of the tRNA molecule. An amino acid binds to 31 end of the…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: How is each tRNA charged with the correct amino acid? What are the consequences of a tRNA carrying…

A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…

Q: Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: A tRNA with the attached amino acid is referred to as “charged.” The amino acid is added at which…

A: The tRNA is the transfer RNA that transfer the amino acids to the growing polypeptide chain. The…

Q: What are the possible codons that a tRNA molecule could interact with if it is carrying each of the…

A: A codon is a triplet nucleotide of DNA or RNA corresponding during protein synthesis to a particular…

Q: If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry? a. Aspartic…

A: An anticodon is the nitrogen base triplet present in the transfer RNA molecule and the codon is the…

Q: Look up a standard genetic code table, how many codons will be recognized by tRNA charged by…

A: Introduction A gene can be defined as sequence of bases that encodes a functional protein molecule.…

Q: Which two functional groups are present in an amino acid? Immersive Reader a Amino and carboxyl…

A: Proteins are linear polymers that are built of monomer units known as amino acids. Nearly 500 amino…

Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…

A: CODON- It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.

Q: If the DNA molecule read its complementary strand as: TACGATCCGAACCAAACT, how would the m-RNA read…

A: The given DNA template is TACGATCCGAACCAAACT The mRNA template would be AUGCUAGGCUUGGUUUGA When…

Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…

A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…

Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…

A: Anticodon is a sequence of three nucleotides on a tRNA molecule that bind to a specific…

Q: Describe the structural features that all tRNA molecules have in common.

A: Introduction tRNA is also referred as Transfer RNA which has a 3D structure like clover leaf. It…

Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…

A: Genetic code is triplet of bases called codon. Genetic code is unambiguous (each triplet specifies…

Q: For each codon below, give the tRNA anticodon. 3. UUC 4. AUC 5. CCG 6. CGU

A: Anticodons are the three complementary bases present on the tRNA. On the basis of the anticodon, the…

Q: Which of the following is true regarding the tRNA structure? The anticodon is found at the 5′ end…

A: Answers : The anticodon is found at the 5′ end of the tRNA molecule. Anticodon is found in the…

Q: Which of the following nucleotide triplets best represents a codon?

A: Introduction:- A codon is a triplet of bases (or nucleotides) in the DNA coding for one amino acid.…

Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: In addition to variable sites, the strucutre of a tRNA includes

A: tRNA tRNA or transfer RNA, sometimes referred as sRNA, is a adapter molecule which read the codon…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: Transcription is the process by which RNA is synthesized from DNA. The genetic material is…

Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…

A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…

Q: A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce…

Q: Which of the following statements best explains why there are many more codons than there are amino…

A: The genetic codon is the sequence of three successive nucleotides present in the mRNA that codes…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…

A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…

A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA…

A: Introduction: A significant class of ribonucleic acids is called transfer RNA (tRNA). During protein…

Q: Which of the following enzymes adds a new amino acid to the growing chain of a protein during…

A: Introduction Protein Translation: the process of reading mRNA and synthesis of a peptide chain of…

Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'

A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…

A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…

Q: Which of the following statements about tRNA molecules is TRUE? Multiple Choice TRNA assumes a…

A: A transfer RNA or tRNA is a special kind of RNA molecule. Work of it is to match an mRNA codon…

Q: Why are 3 nucleotides needed for a codon? Because one nucleotide is redundant Because…

A: There are five nitrogen bases - adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U).…

Q: For each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which…

A: During translation, codons in an mRNA are read, starting with a start codon and continuing until a…

Q: The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair…

A: Normal complementary nucleic acid sequences bind to each other by Watson and Crick base pairing but…

Q: NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?

A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that takes role in the creation of…

Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?…

A: We know that the mRNA carries the codon and the tRNA carries the anticodon. The transfer RNA is the…

Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…

A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…

Q: A particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A. The…

A: The single-stranded RNA is called messenger RNA. The ribosomes read an mRNA when making proteins.…

Q: Match each term with the most appropriate description. sites for polypeptide assembly binds to…

A: All cells have the translation process resides within a specialized organelle which is known as the…

Question

A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's anticodon?*Hint: The codons below do not need to be read from left to right. Use the 5' and 3' directionality to pick out which of the following is the correct answer.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
In the gene-coding sequence shown here, which of the following events will produce a frameshift after the last mutational site? a. insertion of an A after the first codon b. deletion of the second codon (AAA) c. insertion of TA after the second codon and deletion of CG in the fourth codon d. deletion of AC in the third codon
Which of the following is true about tRNA? Select one: A. All tRNAs have a CCA sequence at the 3'-end. B. All tRNAs have a CCG sequence at the 5'-end. C. All tRNAs have a CAC sequence at the 3'-end. D. All tRNAs have a CCA sequence at the 5'-end. E. All tRNAs have a CCG sequence at the 3'-end.
An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of a mutation that changes the C of the anti-codon to a G?
If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry? a. Aspartic acid c. Leucine b. Valine d. Glutamine
Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon that binds to codon in mRNA b. anticodon that binds to codon in ribosomes c. anticodon that binds to codon in tRNA synthetase d. none of the above
In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A. A tRNA without an amino acid attached B. A tRNA with a polypeptide attached C. A tRNA with a single amino acid attached
Include a complete nucleotide monophosphate structure, draw the adenine-uracil basepair that would form between tRNA anticodon loop and an mRNA codon.
If a strand of mRNA contains the sequence, UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
Which of the following is true regarding the tRNA structure? The anticodon is found at the 5′ end of the tRNA molecule. An amino acid binds to the 3' end of the tRNA molecule. An amino acid binds to the anticodon of the tRNA molecule. The nucleotides found in a tRNA molecule can only be adenine, uracil, guanine, and cytosine. One region of the tRNA contains a codon and another region of the tRNA contains an anticodon.
A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon?
The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start codon, what is the third amino acid incorporated into the polypeptide chain?