iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene?

Q: At which level of gene regulation shown in Figure 16.1 does attenuation occur?

A: Attenuation is a process which involves a presence of a stop signal which suggests premature…

Q: 1. What is the effect of RNAI on gene expression? A. Knock out B. Knock down C. Knock up D. Knock in

A: RNAi means RNA interference which is a biological process in which miRNA / siRNA neutralizes the…

Q: 1. Bioinformatics analyses of the genomes of cancer cells from many different patients with…

A: Introduction Cancer is a disease in which some cells in the body grow out of control and spread to…

Q: In gene therapy an attempt is made to transfer a "normal" gene into the cells of a person who lacks…

A: Although gene therapy is a newer concept that has yet to be completely investigated, it has been…

Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Translation is the process which is responsible for synthesis of protein from the mRNA.

Q: 4) The p53 protein normally involves a) DNA repair b) Cell cycle arrest c) Apoptosis d) All of the…

A: p53 is a gene that codes for a protein P53.

Q: Translational control of gene expression occurs within thea. nucleus.b. cytoplasm.c. nucleolus.d.…

A: A gene is the fundamental biology unit just like the atom. Gene expression is the process by which…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: . Why doesn't having a gene variant associated with a particular illness or disorder guarantee a…

A: Genes are DNA structures found in chromosomes. The structure of our genes governs how our bodies…

Q: 1. Since 1978, scientists used a specific biotechnology to produce a medicine used to treat…

A: Technology used: Recombinanant DNA.                 technology. The technology used to make DNA from…

Q: which of the following statements is correct? A proteins make MRNA which then makes genes B genes…

A: Protein synthesis is the essential metabolism occurring in all livings; proteins are made from…

Q: The role of p53 in normal cells is toa. create cancer-blocking mutations.b. trigger unrestrained…

A: Answer- P53 is the tumor supressing gene that is prensent in every cell. Any mutation in this leads…

Q: Post-translational modifications of proteins can affect which of the following? a. protein function…

A: When RNA has been transported to the cytoplasm, it is being translated into protein whose control is…

Q: Explain point  mutations and frameshift mutations. Which is more apt to disrupt the  structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: A mutation within the promoter region can alter transcription of a gene. Describe how this can…

A: 30. A mutation within the promoter region can alter transcription of a gene. Describe how this can…

Q: Which of the following statament is NOT TRUE about gene expression? a. The expression of genes that…

A: Gene expression is the process where cell uses to produce the molecule it needs by reading the…

Q: b. The process by which the DNA instructions are converted into the functional product is called…

A: DNA m-RNA A U G C G C T A T A A U C G T A G C

Q: erm BEST describes the process of increasing mRNA production for a gene in response to a stimulus

A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…

Q: 2. A single human body cell typically contains thousands of structures that contain information. How…

A: A single human body cell typically contains thousand of structure that contain information. How…

Q: 3. Figure on the right shows a DNA microarray assay of gene expression levels. In this microarray if…

A: Micro arrays are utilised for the determination of gene expression patterns in specific tissues or…

Q: In what mechanisms can genetic information be altered? What are the consequences of these changes?

A: Alteration or changes in genetic information is called mutation. Mutation can be spontaneous or it…

Q: How does reverse methylation affect gene expression? Select one: o a. The gene is turned off, but…

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: Expression of a gene, in terms of greater accumulation of the protein it encodes, could be increased…

A: Often biomolecules like protein are produced in our body for any bodily functions. They are specific…

Q: a. b. What constitutes the protein-coding region of a mature mRNA molecule?

A: INTRODUCTION  The process of copying a segment of DNA into mRNA known as transcription. In the DNA…

Q: 2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression

A: Gene expression is the process by which a particular or a set of genes are expressed with the help…

Q: 1. Let's review! The central dogma of molecular biology refers to the process of gene expression.…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual…

A: Muscular dystrophy  It is a genetic disorder, in this disease the muscle of the individual weakens.…

Q: 5. discuss different components and types of epigenetic gene regulation 6. define mutation and…

A: Mutation occurs when the base pair sequence of our DNA changes as a result of numerous environmental…

Q: 1. A neuron and a white cell have very different functions. For example, a neuron can receive and…

A: Hello, thank you for your question. Our policy is to answer one question at a time, I am answering…

Q: B. What is different about the way in which these two DNA sequences increase the rate of…

A: The Catabolite activator protein (CAP) in E.coli activates transcription at more than a hundred…

Q: 1. Nutritional Genomics is the term used to describe: a. How nutrients affect gene expression b. How…

A: Nutrigenetics is a newly developing field where the "we are what we eat" idiom will get an entirely…

Q: 6. The starting scquence of a gene changed from AUGTTCGACGTG, to AUGTTTTCGACGTG What type of…

A: 1)Question asked: What the mutation is ?  Answer: The type of mutation present in the given example…

Q: 4. Write a short paragraph on mutations and how they may alter protein synthesis and function.

A: Introduction :- A mutation is a change in the genetic material in biology. This refers to changes in…

Q: 1. What is RNA? And, how is RNA modified?  2. What are the 3 major steps involved in mRNA…

A: Ribonucleic acid is a molecule similar to DNA. Unlike DNA, RNA is single-stranded.

Q: 3.) How do cis-acting regulatory elements and trans-acting regulatory proteins act in coordination…

A: A trans-acting element is usually a DNA sequence that contains a gene. This gene encodes for a…

Q: d. Where would you find a mutation that affects transcription of this gene? e. Where would you find…

A: A human gene at molecular level consists of several parts like promoter where the transcription…

Q: Vhich statement about DNA methylation is true? D It requires a histone methylase. D It involves the…

A: DNA methylation is a process in which methyl groups are attached to different bases of DNA with the…

Q: 1. How is PKD inherited? What gene is responsible for the expression of PK enzyme ?

A: Pyruvate kinase deficiency is an inherited lack of the pyruvate kinase, that gets used by red blood…

Q: ce between prokaryotes and eukaryotes gene expression c) state the importance of regulating gene…

A: Genes  Genes are defined as nucleotide sequences on the DNA or RNA that specifies a functional…

Q: 5. How the modification and histone interaction with DNA brought to transcriptional silencing. Use…

A: Yeast Saccharomyces cerevisiae (single-celled fungus microorganisms). Since ancient times, the…

Q: 5. A new mutation that arose in one copy of gene X in a somatic cell resulted in the formation of a…

A: Mutation is change that occurs in our DNA sequence, either due to mistakes when DNA is copied or the…

Q: 1. Define gene expression. 2. Why must gene expression be regulated?

A: Gene expression is basically the expression of phenotype in an organism, using the information of…

Q: 2. įmagine that you and your colleagues are working in a lab to develop a protein synthesis system…

A: The prokaryotes have a polycistronic mRNA while the eukaryotes have a monocistronic mRNA. The mRNA…

Q: (2) Design an experiment on how would molecular genetic tools, such as DNA microarrays, be used to…

A: DNA microarray is a molecular technique used to compare the expression of many genes simultaneously.…

Q: True or Flase: Cells must only divide when they receive a signal to divide. 2. BRCA1 is a gene that…

A: All cell must have to go through cell cycle. Cell division requires two major events interphase and…

Q: Gene expression does not vary by_______ . a. cell type c. stage of development b. extracellular…

A: Gene expression is defined as the process wherein genes are read/translated using process-specific…

Q: 14. Complete the following table, which compares late-stage gene regulation mechanisms.

A: The 'Central Dogma' is a process of converting DNA information to RNA, which results in a protein,…

Cancer Therapy