can someone help me with number 5? ParagraphStyles2. What is the purpose of adding the extraction buffer (soap + salt)?The purpose of adding the extraction buffer (soap + salt) is because the soap helps todissolve the phospholipid bilayers of the cell membrane and organelles andthe salt is used to break up protein chains that bind around the nucleic acids.3. Since DNA precipitates out in ethanol, is DNA soluble or insoluble in ethanol? Explain.Ethanol is insoluble in DNA because when we put it in the solution it makes the DNAcome out of solution4. Strawberry species and hybrids can be diploid, tetraploid, pentaploid, hexaploid,heptaploid, octoploid, or decaploid (having 2, 4, 5, 6, 7, 8, or 10 sets of the sevenstrawberry chromosomes, respectively). How will this affect the percentage yield ofDNA?5. Imagine you were asked to extract DNA from the cells of another plant species. Choose3 species of plants and research the size of their genome. How many chromosomesdoes the species have? Is the genome relatively similar in size or highly variable? Whichwould be the best choice for DNA extraction? Why?

DNA extraction from plant tissues is easier compared to animal tissues. Everyday items like shampoo,…

Imagine you were asked to extract DNA from the cells of another plant species. Choose 3 species of plants and research the size of their genome. How many chromosomes does the species have? Is the genome relatively similar in size or highly variable? Which would be the best choice for DNA extraction? Why?

Imagine you were asked to extract DNA from the cells of another plant species. Choose 3 species of plants and research the size of their genome. How many chromosomes does the species have? Is the genome relatively similar in size or highly variable? Which would be the best choice for DNA extraction? Why?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase B) Helicase C) DNA Polyerase D) Primase The genetic code A) has no redundancy but does have ambiguity B) has both redundancy and ambiguity C) has redundancy and not ambiguity D) has ambiguity E) has redundancy
1d) Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?
Question:- When completing genome sequences, contiguous sequences, or contigs are important intermediates. Which of the following is true about contigs? Group of answer choices The smaller the contig, the better it is for a complete genome assembly. A contig represents the sequence production from a single sequencing reaction. A contig is the name for a fragment of DNA made from a larger genomic DNA or chromosome, prior to its sequencing. A contig represents a DNA sequence assembled from smaller sequencing reads, and has no gaps.
True or False? 454 platform sequencing involves attaching single -stranded DNA fragments to beads, which are embedded within a 96-well plate . The plate is exposed to separate washes of single nucleotides , which are used by DNA polymerase to synthesize complementary DNA. Each time a nucleotide is added, a pyrophosphate is released.
Similarities between DNA agarose gels and SDS-PAGE are: Both methods use agarose gels. Both methods use electrical charge differences to separate molecules by size. Both methods determine the size of DNA fragments. All the given answers.
5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
Task A: Polymerase Chain Reaction Master Mix Your first task is to isolate and amplify the NRAS gene from cDNA extracted from different samples through PCR. You will need to run a total of 7 PCRs: 3 normal samples, 3 cancerous samples, and 1 negative control. To make things easier in the lab, when running multiple reactions, the components are prepared not individually, but as a master mix—all the components for multiple reactions are prepared in bulk, except for the template DNA, which is added separately once the master mix has been distributed into individual tubes. The table below lists the different components for PCR, the available stock concentrations of these components, and the needed working concentrations for the PCR itself. Complete the table by supplying the needed volumes of each component for a single reaction and for the master mix (the first row has been filled in as an example).
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C
How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below. Let’s say this DNA is used in a Sanger Sequencing reaction. How long (in nt) will dev the shortest RED nucleic acid chain be given that the red fluorophore is attached re to the ddCTP?
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
GEL ELECTROPHORESIS What is the purpose of gel electrophoresis? During electrophoresis, do the DNA fragments move toward the (+) or (-) end of the gel? What does this indicate about the charge of the DNA molecule? Which size DNA fragments move the furthest through the gel? 4. What is the purpose of staining the gel?