In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In your response, include the following: - differences in what structures (DNA, RNA, proteins etc...) are involved - differences in timing and location - DO NOT include any details on what happens after transcription

In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In your response, include the following: - differences in what structures (DNA, RNA, proteins etc...) are involved - differences in timing and location - DO NOT include any details on what happens after transcription

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SA: Put the following processes in order of their occurrence during expression of a eukaryotic gene: a....

See similar textbooks

Similar questions

Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?a) ribosome assemblyb) rRNA gene transcriptionc) telomerase assemblyd) tRNA processinge) all of the above Please explain choices
in not more than five sentences, compare and contrast prokaryotic from eukaryotic translation. expound on at least three differences
Compare and contrast bacterial and eukaryotic translation.
Give an overview of the process of translation in prokaryotes with at least 10 bullet points.
Please describe in detail the process of translation for a Prokaryotic cell, from initiation of translation to termination of translation.
How is molecule 3 Reverse transcriptase? Isn't that an enzyme and not a molecule nor product? The question is asking for a molecule or product
Why do prokaryotic organisms translate mRNA molecules while being transcribed? Group of answer choices Prokaryotes lack nuclear membranes to separate DNA and mRNA from protein-synthesizing equipment. Prokaryotes use reverse transcriptase to simultaneously translate and transcribe mRNA. Prokaryotes use pre-mRNA to translate, while transcription occurs within the cell. Prokaryotes have functional mRNA that yields portions of the transcribed mRNA into the cytoplasm to allow for translation to occur.
Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:
Which of the following statements is/are TRUE about the difference between prokaryotic and eukaryotic translations? A. The chain elongation step is the most different process. B. Eukaryotes have less elongation factors than in prokaryotes. C. The release factors in prokaryotes can bind to all three stop codons. D. The fMet and Met are the 1st amino acid in prokaryotes and eukaryotes, respectively.
Please answer asap and in short and content should not be palgarised please For each of the following RNA molecules: Indicate if it is Required or Not for translation in prokaryotes and, if it is required, what does it do? mRNA tRNA rRNA snRNA
Can someone please draw a diagram to explain transcription and translation and difference in eukaryotes and prokaryotes listed
All of the following are involved in initiation of protein translation in prokaryotes, EXCEPT Question 41 options: IF1 GTP IF3 Rho factor IF2