In humans, as well as in many other animals and some plants, the sex of the individual is determined by sex chromosomes The sex chromosomes are one pair of non-homologous chromosomes: XX represents a female, while XY represents a male. When a gene for a specific trait is attached to the Xor Y chromosome, we say it is sex-linked, and when it is attached to the X chromosome, we say it is X-inked. Alleles for these linked traits, such as hemophilia or color blindness, crosses, may be recessive or dominant Hemophilia is an X-linked, recessive trait. The recessive allele for hemophilia is actually a mutated version of the normal allele but it can stiu be passed on through generations. Imagine a female is a carrier for hemophilia her genotype is Xx. She is married to a man who does not have hemophilia What conclusion is NOT vatid concerning this genetic cross?

In humans, as well as in many other animals and some plants, the sex of the individual is determined by sex chromosomes The sex chromosomes are one pair of non-homologous chromosomes: XX represents a female, while XY represents a male. When a gene for a specific trait is attached to the Xor Y chromosome, we say it is sex-linked, and when it is attached to the X chromosome, we say it is X-inked. Alleles for these linked traits, such as hemophilia or color blindness, crosses, may be recessive or dominant Hemophilia is an X-linked, recessive trait. The recessive allele for hemophilia is actually a mutated version of the normal allele but it can stiu be passed on through generations. Imagine a female is a carrier for hemophilia her genotype is Xx. She is married to a man who does not have hemophilia What conclusion is NOT vatid concerning this genetic cross?

Name: UnaffectedfatherCamiermotherXYUnaffectedAfectedCarrierUnaffeded Unaff
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: UnaffectedfatherCamiermotherXYUnaffectedAfectedCarrierUnaffeded UnaffecteddaugkterU.S. National Lbrany of MedicheCarrierAffectedsondaughtersonIn humans, as well as in many other animals and some plants, the sex of the individual is determined by sex

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter14: Chromosomes And Human Inheritance

Section: Chapter Questions

Problem 6SQ: Choose the statement that is incorrect. a. A son can inherit a recessive allele on an X chromosome...

See similar textbooks

Similar questions

Do all genetic diseasesresult from alteration in thenumber of chromosomes ofthe cells?
With regard to the analysis of chromosome structure, explain theexperimental advantage that polytene chromosomes offer. Discusswhy changes in chromosome structure are more easily detected inpolytene chromosomes than in ordinary chromosomes.
A small fraction—2 to 3%—of all cancers, acrossmany subtypes, displays a quite remarkable phenome-non: tens to hundreds of rearrangements that primarilyinvolve a single chromosome, or chromosomal region.The breakpoints can be tightly clustered, with several in afew kilobases; the junctions of the rearrangements ofteninvolve segments of DNA that were not originally closetogether on the chromosome. The copy number of varioussegments within the rearranged chromosome was foundto be either zero, indicating deletion, or one, indicatingretention.You can imagine two ways in which such multi-ple, localized rearrangements might happen: a progressiverearrangements model with ongoing inversions, deletions,and duplications involving a localized area, or a cata-strophic model in which the chromosome is shattered intofragments that are stitched back together in random orderby nonhomologous end joining (Figure Q20–2).A. Which of the two models in Figure Q20–2 accountsmore readily for the features of…
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
why wxactly 20Atp not 24?
A research paper published in the summer of 2012presented a method to obtain the whole-genome sequence of a fetus without any invasive procedure suchas amniocentesis that could on rare occasions causemiscarriage. This new technique is based on the factthat some fetal cells leak into the mother’s bloodstream and then break down, releasing their DNA.Assume that exactly 10% of the DNA fragments inthe mother’s blood serum come from the fetus, whilethe remaining 90% of the DNA fragments in the serum come from the mother’s genome.The investigators collected cell-free DNA from apregnant woman’s bloodstream and subjected it to anadvanced high-throughput sequencing method. Thetable at the end of this problem looks at seven unlinked loci; the number of reads of particular alleles(identified by Greek letters) are shown. You shouldassume for the sake of simplicity that all numericaldifferences are statistically significant (even thoughactual data are never this clean).a. Determine whether each…
SCRAMBLED WORDS: 1. Arrange the scrambled words to form a term related to genetics. 2. After you have formed the words, describe or define the new terms. ennamoidc plluitem leeasll peissaist helatl llaese dooceacminm
Imagine that you have been given several bacterial strainsfrom various countries around the world and that all thestrains are thought to cause the same gastrointestinal diseaseand to be genetically identical. Upon carrying out a DNAfingerprint analysis of the strains, you find that four differentstrain types are present. What methods could you use to testwhether the different strains are actually members of the samespecies?
Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?b. Can you think of other methods to determinewhether an allele represents the null state of a particular gene?
Match the chromosome disorder to its descriptionin the key. Jacobs syndrome a. female with undeveloped ovaries and uterus, unable to undergopuberty, normal intelligence, can live normally with hormonereplacementb. XXY male, can inherit more than two X chromosomesc. male or female, mentally impaired, short stature, flat face, stubbyfingers, large tongue, simian palm creased. XXX or XXXX femalee. caused by nondisjunction during spermatogenesis
Choose the statement that is incorrect. a. A son can inherit a recessive allele on an X chromosome from either parent. b. An individual may inherit three or more of each type of chromosome characteristic or the species, a condition called polyploidy. c. A female child inherits one X chromosome from her mother and one from her father. d. Pedigree analysis can be used to determine a future childs chance of being born with achcondroplasia.
A boy with Klinefelter syndrome (47,XXY) is born to a motherwho is phenotypically normal and a father who has the X-linkedskin condition called anhidrotic ectodermal dysplasia. The mother’sskin is completely normal with no signs of the skin abnormality.In contrast, her son has patches of normal skin and patchesof abnormal skin. Question: Using the appropriate genetic terminology, describe themeiotic mistake that occurred. Be sure to indicate in whichdivision the mistake occurred.