In kilodaltons (KDa), what is the predicted molecular mass of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? Answer in numerical digits only
Q: Choose below the order of plasma lipoproteins based on the particle size (from smallest to largest):…
A: Lipoproteins are particles made of protein and lipids. They are responsible for carrying cholesterol…
Q: Give a detailed account of the tricarboxylic acid pathway and how it is regulated in eukaryotic…
A: The citric acid cycle (CAC), sometimes referred to as the Krebs cycle and the tricarboxylic acid…
Q: Consider a defect in MIG12 that prevents the binding of this protein to acetyl-CoA carboxylase. How…
A: Introduction: Acetyl carboxylase is a multifunctional enzyme that contains three functional domains…
Q: Among the given statements, which ones are true for phospholipids? 1. They are anionic or…
A: Lipids are biomolecules, which are non-polar in nature. They are classified as simple lipids,…
Q: 3.(12pts) What is the ratio of NH4+/NH3 for a 0.5M solution of NH4Cl at pH 9? (The pKa of NH4+ is…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: 1. Weigh 1 g of isolated polysaccharide sample (sweet potato starch) in a 10 mL beaker using an…
A: A solution is prepared by dissolving a solute into a solvent, and the concentration of solute can be…
Q: What does an area of clearing indicate in biochemical test?
A: Measuring a nutrient or its metabolite in the blood, faeces, urine, or other tissues that have a…
Q: Mercury poisoning would affect which of the following? OA) Pyruvate dehydrogenase complex. B)…
A: Mercury poisoning is a disease caused by exposure to mercury or its toxic compounds. Mercury is a…
Q: At which temperature given does hemoglobin have a higher affinity for oxygen?
A: Hemoglobin is a protein that transports oxygen from lungs to tissues and CO2 from tissues to lungs.…
Q: ）picture1: what bond is this between cytosine and ribose？ 2）picture2 ： what bond is that bewteen…
A: Nucleotides are compounds made up of a nitrogen base, a sugar and a phosphate. The base can be…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: In the synthesis of urea, one nitrogen atom comes from ammonia, the other comes from: ○ A) fumarate.…
A: The urea cycle (or ornithine cycle) is a cycle of biochemical reactions that produces urea from…
Q: 2-phosphoglycerate ATP or acetyl CoA glucose ATP or NADH ADP ATP NADH ADP or acetyl CoA pyruvate…
A: Glycolysis is a process in which one molecule of glucose is converted into two molecule of pyruvate…
Q: *While acetyl-SCOA activates pyruvate carboxylase, it inhibits pyruvate kinase. Explain how this is…
A: Complementary control is a type of metabolic regulation by which 2 complementary pathways are…
Q: One xylulose 5-phosphate, One glyceraldehyde 3-phosphate, One sedoheptulose 7-phosphate, 1…
A: After glucose enters the cell it is immediately phosphorylated into glucose 6-phosphate. Glucose…
Q: TRUE OR FALSE 1. The H chain contains one variable and one constant domain. 2. The processes that…
A: Immunoglobulins are the Y shaped complex molecules that are proteins in nature.they can be referred…
Q: Eukaryotic RNA polymerase II resembles the prokaryotic RNA polymerase core. Which of the following…
A: Prokaryotes have only one RNA polymerase called prokaryotic RNA polymerase, but eukaryotes have…
Q: 9. Compartmentation in ß Oxidation Free palmitate is activated to its coenzyme A derivative…
A: Beta oxidation is the biochemical pathway by which fatty acids are broken down two carbon at a time…
Q: DNA Extraction and Characterization from Shrimp Describe the resulting gel, assess the purity of…
A: Here, given is a picture of sample gel. The distance of migration of bands in the ladder is given in…
Q: Explain how the information in mRNA is converted into a fully folded protein, and how the misfolding…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: Peptides have been discovered that display anti-inflammatory properties and show promise as new…
A: MTADV is a synthetic pentapeptide which can be a potential novel drug with anti-inflammatory…
Q: Although as a whole, metabolic pathways are thermodynamically favorable, there’s at least one…
A: The Delta G of a reaction can be calculated as follows. Delta G = Delta G0 + RTln(Q) Where R =…
Q: c) Explain why the proton Mitchel's proton gradient mechanism is implausible. What is the most…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) is well…
Q: Identify the structures a-d. (a) (b) (c) (d)
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: SEMINAR TOPIC Role of oxidative stress in the pathogenesis and complications of diabetes
A: Oxidative stress is caused by disparity between production and accumulation of oxygen reactive…
Q: Deficiency in HGPRT will lead to what? a. No synthesis of ATP b. No salvage pathway for all purines…
A: Hypoxanthine- guanine phosphoribosyl transferase (HGPRT) is required in salvage pathway which is…
Q: 1 the overall structure of DNA is double helical and the bases between each strand form watson-…
A: DNA or deoxyribonucleic acid is the fundamental component of all cells. It constitutes the genetic…
Q: The ultimate acceptor of electrons in the nadh electron transport chain is a. H+ b. ATP c. O2…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…
Q: Question 13 1 The binding of seven molecules of ATP at the apical domain of the GroES causes the…
A: Since you have asked multiple questions, we will solve the first question (Question No. 13) for you.…
Q: Serine proteases are involved in the control of blood coagulation, fibrinolysis, complement…
A: Serine proteases - are enzymes which cleaves peptide bond by formation of catalytic triads and Ser…
Q: A TCL was run with 5 subjected samples utilizing a silica plate and ethanol/chloroform in mobile…
A: TLC (thin layer chromatography) is a type of partition chromatography, in which the samples are…
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination is a type of reaction in which, the amino group of an amino acid is transferred as a…
Q: QUESTION 21 Match the following metabolic reactions or components with their corresponding cellular…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: The carbon-carbon bond distance for single-bonded carbons, such as those in a saturated fatty acyl…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: Proteins are high molecular weight polymers of amino acids that serve diverse functional roles in…
Q: Question 11 Matching: (one answer can be matched to more than one questions). An answer can be used…
A: Liposomes and micelles are composed of phospholipids. Lets first know the characteristics of…
Q: 5. ( Polyphenoloxidase is involved in the darkening of wheat products due to its oxidative effect on…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: PLEASE HELP 1. How many chirality centers does ribose have? Identify them.
A: Chirality is a property that is exhibited by molecules that cannot be superimposed on their mirror…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: All processes that would end up releasing energy will take place spontaneously. This energy released…
Q: Long chains of beta glucose monomers are held together in microfibril bundles by bonds Vanderwaals…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Age-related macular degeneration (ARMD) within the eye is a disease that is closely related to…
A: Age-related macular degeneration (ARMD) is an ocular disease causing damage to the retinal macula,…
Q: Citric Acid Cycle Notes? C² 1000 K
A: In aerobic condition, pyruvate in the presence of pyruvate dehydrogenase complex produces Acetyl…
Q: The following assays is/are considered a DIRECT ASSAY: A. absorbance B. рн C. Viscosity D. All of…
A: Process of analyzing a substance to determine its composition or quality is an assay. In medicine,…
Q: A protein has a dissociation equilibrium constant equal to 4.0um. What is the concentration of free…
A: Consider the following reaction: P + L ⇌k2k1 PL where P is the protein, L is the ligand and k1 and…
Q: Choose the correct path taken by a pair of electrons as they travel down the electron-transport…
A: Electron transport chain consists of a group of protein complexes in the mitochondrial membrane…
Q: How DMT affects the brain?
A: Introduction Neurotransmitters are a type of chemical messengers that transmit chemical signals…
Q: Why was it necessary to use phosphoaminophosphonic acid-adenylate ester (ANP) in the ATP synthase…
A: As per the chemiosmotic Model, ATP synthase is the enzyme that phosphorylates ADP with Pi as…
Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…
A: Qualitative tests are used to determine for the presence or absence of any substance in the given…
Q: Briefly describe why mammals can not convert fatty acids to carbohydrates? Why plants can do so?…
A: Lifeforms are more or less a controlled and well regulated chemical lab in themselves. A whole lot…
Q: Rationalize the use of all the reagents used in Agarose gel electrophoresis.
A: Agarose gel electrophoresis is a technique used to separate nucleic acids based on the size. The…
In kilodaltons (KDa), what is the predicted molecular mass of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? Answer in numerical digits only
Step by step
Solved in 3 steps
- What is the expected molecular weight of the protein encoded by the sequence provided here: ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGTAGGTGCACTTGGTGATGTGAGTCTGGGCTGAUse the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?A hypothetical protein has a molar mass of 23,300 Da. Assume that the average molar mass of an amino acid is 120. • How many amino acids are present in this hypothetical protein? • What is the minimum number of codons present in the mRNA that codes for this protein? • What is the minimum number of nucleotides needed to code for this protein?
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?Assume you were given a mixture consisting of one molecule each of all possible sequences of a smallish protein of molecular weight 4800 daltons. If the average molecular weight of an amino acid is, say, 120 daltons, how much would the sample weigh? How big a container would you need to hold it?
- Avidin exists as a protein complex of around 68 kDa. Research to determine the types of interactions that hold the avidin complex together. Based on your research, which molecular weight would you expect for avidin when treated with beta-mercaptoethanol and run through an SDS-PAGE gel? Question options: 34 kDa 19 kDa 68 kDa 11 kDaThe protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?Suppose you calculate that you can load 2000ng of Sample A and suppose your concentration of Sample B is 450ng/uL. How many uL of Sample B would you need to load the same amount of protein into the gel?
- Question 9. // Help solve the picture and the questions that were cut off from the picture attached. What are the molecular weights of the protein X polypeptides? (pick 1 only)- 50 kDa each- 60 kDa and 30 kDa- 70 kDa and 30 kDaWhat are the molecular weights of the protein Y polypeptides? (pick 1 only)- 60 kDa, 50 kDa, and 30 kDa- 50 kDa each- 60 kDa and 30 kDaA protein sample of unknown concentration was placed in a cuvette with a path length of 1 cm and the sample was found to have an A280 value of 2.92. If the protein of interest has an extinction coefficient of 44240 M-1 cm-1 and the molecular weight of the protein is 47.411 kDa, what is the concentration of protein in mg/mL?In order to prepare a standard curve, you will do serial dilutions of the standard protein. Assume the protein concentration in tube A is 3 mg/ml and you take 0.5ml and add it to the next tube (tube B) containing 0.5ml of buffer. What is the concentration in tube B?