Answered: In monounsaturated fatty acids, the…

In monounsaturated fatty acids, the presence of a double bond is usually found at the position between carbons 9 and 10. 3 and 16. 8 and 9. 11 and 10.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter3: The Chemistry Of Life: Organic Compounds

Section: Chapter Questions

Problem 7TYU: Saturated fatty acids are so named because they are saturated with (a) hydrogen (b) water (c)...

See similar textbooks

Related questions

Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?

A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: Which among the following statements is correct? O lon-exchange chromatography is dependent on the…

A: Introduction: Chromatography is an analytical technique for the separation of different dissolved…

Q: te the structure for a generic triacylglyceride at pH 7.4.

A: ''Since you have asked multiple question , we will solve the first question for you . If you want…

A: hnRNA is a heterogenous RNA , also called as pre mRNA formed by the enzyme called RNA pol 2 ,…

Q: Consider the beta oxidation of stearic acid (C18:0): How many ATP are generated in complete…

A: Stearic acid has 18 C so 8 cycles are involved in its beta oxidation, One cycle yield 1 FADH2 and 1…

Q: If a person has a medical condition in which their mitochondria do not function properly, what…

A: Mitochondria are popular as the powerhouses of the cell. It is the organelle which specifically act…

Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…

A: An antagonist is a particular drug that blocks opioids by attaching to the specific opioid receptors…

Q: How does compromised pyruvate kinase activity lead to anemia?

A: Pyruvate kinase is a catalytic enzyme that catalyzes the final step of glycolysis, which is crucial…

Q: What is the name of proteins that hold DNA in coils or V shapes in Bacteria?

A: SMC : SMC is structural chromosome maintenance .These complexes belongs to the family of ATPases…

Q: How does ground state destabilization, transition state stabilization, and proximity lead to…

A: Enzymes are protein molecules that speed up the biochemical reactions by decreasing the activation…

Q: Glucose is phosphorylated to glucose-6-phosphate by hexokinase in the first step of the glycolytic…

A: Reactions that have a positive value of Delta G are not favorable in nature. Hence in order to…

Q: What term describes the expression of gene products that are needed in consistent amounts all of the…

A: Gene expression is the process through which information from a gene is used to make a functioning…

Q: Draw the reactions and the interpretation on the lysine iron agar (lia) test for Proteus vulgaris

A: Proteus vulgaris is a gram negative, rod shaped facultative anaerobe in the Enterobacteriaceae…

Q: heat the samples. Would increasing the concentration of acid in the solution, in lieu of heating,…

A: In Barfoed's test heating is used to break the bonds between the disaccharides forming…

Q: 9. If 32p-labeled inorganic phosphate were introduced to erythrocytes undergoing glycolysis which of…

A: Glycolysis is the process of conversion of one molecule of pyruvate into two molecules of pyruvate.…

Q: The following structure is D-sorbose. Which reagent will oxidize D-sorbose? CH2OH C = 0 Н-С-ОН НО -С…

A: Sorbose is a ketose belonging to the group of monosaccharides

Q: What are the steps in extracting DNA from a Banana using simple household materials like dishwashing…

A: DNA extraction from banana is most commonly followed as banana is triploid with three sets of…

Q: A280/ A260 of 1.3. Estimate the pro 1. A solution of a purified protein yielded 0ontration of the…

A: Standard curves of purified reference proteins are used to determine the concentration of the…

Q: Carbon monoxide is lethal at low concentrations yet it plays an important role in cell signalling…

A: During the breakdown of heme, carbon monoxide (CO) is continually created in mammalian cells. CO is…

Q: Solve the following problems using the basic assumptions: 1 NADH --> 2.5 ATP; 1 FADH2 --> 1.5 ATP…

A: When there is no carbohydrates available in the body, the fatty acids undergo β-oxidation to yield…

Q: 44. Roy's doctor recommended that he watch his blood cholesterol level because his of reading of…

A: In a person, the total level of cholesterol should be always less than 200 mg/dL for a healthier…

Q: What are massive, insoluble, high molecular weight compounds that have brown color? Not…

A: The brown pigment observed in different foods such as cookies, breads etc is the result of a…

Q: 1. Write the ten reactions of the glycolytic pathway, naming all enzymes and providing the…

A: Glycolysis is a process in which one mole of glucose is partially oxidized into the two moles of…

Q: In one (1) sentence point out a key functional similarity and difference in each of the pair of…

A: Aminoacids are the building blocks of proteins that are classified as acidic , basic and Amino acids…

Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for…

A: The TCA cycle or tricarboxylic acid cycle is the second stage of cellular respiration. This is a…

Q: In the case of autosomal recessive mutations, the frequency of the disease in a population is…

A: Autosomal recessive inheritance It is a particular way of genetic trait or condition which can be…

Q: Which of the following statements are correct? Explain your answers.A. An atomic nucleus contains…

A: Since the atom and nucleus were discovered. The bonding of a proton and a neutron, a proton and a…

Q: Which snRNP leaves in order to form the active spliceosome? OU1 U3 OU4 U2

A: At least five different types of snRNPs join mainly the spliceosome to specifically participate in…

Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…

A: Nucleic acids are constituted of nucleotides linked via phosphodiester linkages while proteins are…

Q: Two dimensional electrophoresis separates proteins according to their isoelectric focusing and mass.…

A: Two dimensional electrophoresis:- powerful electrophoretic method for separation and analysis of…

Q: All of the following elements are involved in the signaling cascade that promotes glycogen breakdown…

A: INTRODUCTION- Glycogen is the major storage form of glucose mainly in the liver and muscle, glycogen…

Q: Adeno-associated viral vectors integrate into the genome of non-dividing or slowly dividing cells.…

A: Adenoviruses are non-enveloped viruses with a double-stranded DNA genome and an icosahedral…

Q: A single gene mutation causing several, and seeming unrelated problems is called Entropy Pleiotropy…

A: The diseases that are caused due to single gene mutation are known as single gene disorders.

Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…

A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…

Q: Which subunit of RNA Pol I| functions as an assembly platform and regulator of pre- MRNA processing?…

A: In eukaryotes the pre mRNA that is the product of transcription undergoes several steps of…

Q: (a) Lock and key model versus induced fit model of enzyme activity.

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Indicate at what step number in the glycolysis pathway the following event occur and why? a. First…

A: Isomerisation is defined as the reaction which alters a compound into its simple isomers which…

Q: According to the search results from question 7, which of the following lipids is (currently) only…

A: Human body contains many sialic acid containing gangliosides or glycosphingolipids such as GM1,…

Q: (a) Draw the condensed structural formula, and give the name and abbreviation for the dipeptide…

A: Dipeptide is the structure formed by two aminoacids with a single Peptide bond. Anomeric carbon is…

Q: What is the difference between gain of function and loss of function mutations?

A: Mutations is a change in a DNA sequence that can be caused due to DNA replication error made during…

Q: Which of the following bind to the motif GGAGG in human COLQ gene? SRSF1 hnRNPH Both None

A: RNA is a vital component of the cell that is required for a variety of biological functions,…

Q: Question 8 Which of the following IS a Phase Il metabolic reaction? O Fornation of a ketone at a…

A: Question 8 ans: Phase l metabolism is when a parent drug is converted to polar active mrtabolite…

Q: topic: gel electrophoresis What is the purpose of the running buffer?

A: The gel electrophoresis is a biochemical technique, which helps to separate the proteins and DNA,…

Q: Which of the following functions is NOT or cannot be performed by lipids? They can bind to DNA…

A: Lipids are a macro biomolecules made of fatty acid monomers, naturally occurring organic compounds…

Q: c. Ribulose 5-phosphate levels would decrease. d. NADH to NAD+ ratios would decrease. e.…

A: In the RBC's of the patients certain changes are observed. Ribulose 5 Phosphate levels would…

Q: What are the structural features of 7N7H (Viperin-like enzyme)? a) Must show 3D structure

A: An enzyme is a biological catalyst. it is usually protein. 'Viperin' is a member of the radical…

Q: A glycosidic bond between two monosaccharides can also be classified as a(n) ________

A: Monosaccharides are the basic sugar unit of carbohydrates compounds. Monosaccharides which cannot be…

Q: Which polymerase transcribes genes with internal control regions (ICR)? ORNA Pol I RNA Pol III RNA…

A: DNA sequences located within the coding region of eukaryotic genes that bind regulatory elements…

Q: Hydrolysis of a mixture of glycerophospholipids may yield the following, EXCEPT: A. Galactose B.…

A: The Glycerophospholipids (GPL) are the major structural lipid components of the eukaryote cellular…

Question

In monounsaturated fatty acids, the presence of a double bond is usually found at the position between carbons
9 and 10.
3 and 16.
8 and 9.
11 and 10.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Unlike saturated fatty acids, the tails of unsaturated fatty acids incorporate one or more _______. a. phosphate groups b. glycerols c. double bonds d. single bonds
C6H12O6 is the chemical formula for a ________. polymer of carbohydrate pentose monosaccharide hexose monosaccharide all of the above
In the following list, identify the carbohydrate, the fatty acid, the amino acid, and the polypeptide: a. NH2CHRCOOH b. C6H12O6 c. (methionine)20 d. CH3(CH2)16COOH
Saturated fatty acids are so named because they are saturated with (a) hydrogen (b) water (c) hydroxyl groups (d) glycerol (e) double bonds
Lactose is a disaccharide formed by the formation of a bond between glucose and glycosidic; lactose glycosidic; galactose hydrogen; sucrose hydrogen; fructose
In monounsaturated fatty acids, the presence of a double bond is usually found at the position between carbons ______________. 11 and 10. 8 and 9. 3 and 16. 9 and 10.
A fatty acid is designated as having the structure 18:2 ( 9,12). Draw the structure of the fatty acid.
Describe the four functional groups of carbon 2 based on a typical saturated fatty acid.
D-Erythrose and D-threose are referred to as _____________ because their structures only differ in the configuration at one asymmetric carbon atom.
Two of the 20 common amino acids have two chiral carbon atoms in their structures. Identify these amino acids and their chiral carbon atoms.
Draw the condensed structural formula for a monounsaturated omega-3 fatty acid with 12 carbon atoms
The geometric isomer of fumarate is the _____________ isomer. The sp3 stereocenter in both malate and the β-hydroxy fatty acid is the _______ isomer.