topic: gel electrophoresis What is the purpose of the running buffer?
Q: . Adding as little as 0.1 mL of concentrated HCl to a liter of H20 shifts the pH from 7.0 to 3.0.…
A: Acetic acid and sodium acetate is an example of the acid - base buffer, in order to understand how…
Q: The process of protein decomposition by pepsin enzymes in stomach is assumed and modeled as a batch…
A: The reaction kinetics given in the pepsin digestion reaction follows Michaelis-Menten Kinetics. The…
Q: COO co0 C=0 C=0 + CH2 ČH3 COO The name of enzyme that catalyzes above reaction is Select ] and the…
A: Here, a reaction is given in the question and we have to identify the enzyme which catalyzes this…
Q: explain the function of present vitamin c in oxalic acid
A: Many plants contain oxalic acid, which can be found in leafy greens, vegetables, fruits, chocolate,…
Q: 2. Explain the difference between saturated and unsaturated fats.
A: Fats often refers to triglycerides which is esters of glycerol and fatty acids. One glycerol can be…
Q: Basic structural component of Lipids, Protein and Enzymes?
A: A biomolecule, sometimes called a biological molecule, is any of the numerous chemicals produced by…
Q: 5. Use this figure to summarize how the ATP is used as energy "currency", harnessing some of the…
A: ATP is used as a energy currency due to the presence of two high energy phosphoanhydride bonds…
Q: D Question 6 6. The following table summarizes properties of three different proteins. Two would be…
A: Chromatography is an analytical technique for separating components of a mixture
Q: See attached. Write the important biomolecules in the nutrition facts and conclude whether the…
A: The nutrients required by the body are classified as macronutrients and micronutrients based on the…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: (Q39) A mutation in a certain protein results in the presence of a cysteine residue (rather than the…
A: Answer 39) A mutation is considered as a change in a DNA sequence. Mutations can easily result from…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: How many molecules of water are produced by the electron transport chain during the complete aerobic…
A: Stearate is saturated fatty acids. It is metabolized by beta oxidation in the cytoplasm. It releases…
Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: How is a “committed step” defined in the context of a metabolic pathway and why are they important?…
A: A metabolic pathway is a chain of biochemical reactions linked together by their intermediates.…
Q: What is the heterozygous advantage of people having sickle-cell trait in areas where malaria is a…
A: Introduction: Sickle cell anemia is an autosomal inherited blood disorder that affects hemoglobin…
Q: What is the molecular weight of a linear polysaccharide consisting of 7 galactose monomers and 1…
A: Glucose and galactose are monosaccharides that are also referred to as simple sugars. They represent…
Q: HbA1c is a glycated hemoglobin in which a glucose molecule is covalently bound to the N-terminal…
A: Hemoglobin is an iron-containing oxygen-transport metalloprotein found in nearly all vertebrates'…
Q: II. GENERAL INSTRUCTIONS Answer the following items. 1. Give an example of a catalyst and its…
A: Tri carboxylic acid cycle or the citric acid cycle, TCA cycle or the Krebs cycle is a series of…
Q: Using a 1 cm cuvette, the absorbance at 260nm of your double-stranded DNA sample is 0.15. What is…
A: Lambert-Beer's law can be used to calculate the concentration of DNA in a sample. It states that the…
Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…
A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…
Q: 4. Enzymes in an enzymatic reaction do not interfere with: a. free energy of reaction b. rate of…
A: Enzymes are the biological catalysts that speed up the rate of reaction by lowering the activation…
Q: (A) Generally, outline how you could produce or isolate such a species. (B) Once you have obtained a…
A: In the question, reaction presented is hydrolysis of a peptide bond of a dipeptide. The dipeptide…
Q: A biological Claisen reaction occurs in the conversion of two acetyl CoA molecules to one…
A: Introduction: The condensation reactions involve the formation of new carbon-carbon bonds. The most…
Q: gel electrophoresis
A: Gel Electrophoresis is a simple , rapid and analytical technique which is used for separating the…
Q: What are massive, insoluble, high molecular weight compounds that have brown color? Not…
A: The brown pigment observed in different foods such as cookies, breads etc is the result of a…
Q: Why are unsaturated fats considered healthier?
A: Unsaturated fatty acids consist of a double bond between molecules of the fatty acid chains, whereas…
Q: a) Give an appraisal of prokaryote cell lines as recombinant polypeptide expression systems. (b)…
A: The bacterial expression system is widely used for the recombinant expression of mammalian proteins.…
Q: 8. Which of the following is commonly known as the Complex II of the electron transport system of…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: Can I have help with number 2 and 3? 2) 2What is the specific function of the enzyme catalase? 3)…
A: Partial reduction of oxygen in the electron transport chain and peroxidation of lipids cause the…
Q: CH,O-P-o C=O 0. CH,O-P-o- CH-OH C=O Ó. HO-C-H H-C-OH H-C-OH O C-H of ČH;O-P-0- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: In the last 40 years, scientific understanding of retroviruses has increased dramatically. The word…
Q: 1. Foods cannot be compared without determining the “per gram" values. Explain the reasoning behind…
A: Nutrients are substances required by the body, for the growth and development, reproduction, and to…
Q: Does SARS-CoV-2 conform to the central dogma of molecular biology that was coined by Francis Crick?…
A: Introduction: SARS-Cov-2 is a member of a large family of viruses called coronavirus disease 19…
Q: Amino acids with non-polar side chains are zwitterions at a. middle pH levels, between the pKa’s of…
A: Amino acids are compounds with an amino group, a carboxyl group, a hydrogen atom, and a variable…
Q: 12 If strong-base anion exchange resin is applied to treat raw water with silicate, the pH of raw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Which statement about gluconeogenesis is FALSE? Group of answer choices For starting materials, it…
A: Gluconeogenesis is the biochemical pathway by which pyruvate is converted into glucose.
Q: (a) What is a reducing sugar? (b) Give an example of a reducing sugar (c) What test can be used to…
A: a. Reducing sugar:- Any carbohydrate thta reacts with an oxidising agent to form an aldonic acid is…
Q: Calculate the free energy change for glucose entry into cells when the extracellular concentration…
A: Free energy change The change in free energy (ΔG) is basically the difference between the heat…
Q: Н. Based on what you know about the classification and structure of galactose, HO- what possible…
A: Galactose is a simple monosaccharide aldohexose and a C-4 epimer of glucose, and a precursor to…
Q: Which statement regarding glycolysis is TRUE? Group of answer choices Both substrate-level…
A: Glycolysis is the process of oxidation of one mole of glucose into two moles of pyruvate. It occurs…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: DPCC: Diphenylcarbamyl chloride has two phenyl group attached to carbamyl chloride. Serine Protease:…
Q: O dihydroxyacetone-P DHAP ATP ADP ATP ADP glucose-6-P G-6-P fructose-6-P F-6-P glucose…
A: In the diagram glycolytic pathway, pentose phosphate pathway and Leubering- Rapport shunt is given…
Q: Make a concept map covering about the following: a. SYPHILIS b. Anti-Streptolysin O Test (ASO TEST)…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…
A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…
Q: Enzyme: Crystal Structure of Wild-Type Human Phosphoglucomutase-1 (PGM1) the description of the…
A: The enzyme PGM1 is very well known for its central role in specific human metabolism, where it…
Q: An unknown solution contains a single pure sugar. It gives positive results to Molisch’s and…
A: The qualitative tests are used to identify the presence of certain sugar in the given sample.…
Q: Which of the following products of the non-oxidative stage of PPP is an intermediate in the…
A: PPP : Pentose phosphate pathway The non-oxidative phase of PPP links the glycolysis to the pentose…
Q: 4. Draw the number of fragments as well as their sizes as they would migrate on the electrophoresis…
A: Sal1 is a restriction endonuclease i.e it cleaves DNA at the recognition sequence 5'-G/TCGAC-3'…
Q: Microbes can provide beneficial activities. Bioremediation (using bacteria) is a process used to…
A: Bioremediation is a waste management technique. Living organisms can be used in this process to…
topic: gel electrophoresis
What is the purpose of the running buffer?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- topic: gel electrophoresis . What are other staining methods that can be used for PAGE?Define about sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)? Explain importance of sodiumdodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) ?Give detailed Solution (no need Handwritten)