What term describes the expression of gene products that are needed in consistent amounts all of the time? O comprehensive
Q: Procedure: 1. Dissolve one teaspoon or one packet of active yeast in a small amount of warm water.…
A: Hi, thanks a lot for submitting multiple questions and as you have asked to answer 5, 6 and 7…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…
A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…
Q: 1) Given the structure of pyruvate below, draw the reaction with NADH to form lactate. (only the…
A: Pyruvate is the end product of the glycolytic pathway. Under aerobic condition, the pyruvate…
Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…
A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…
Q: find stereochemistry, (from the structure) , rotational bond and geometrical / optical isomer for…
A: Phenyotin is a synthetic compound and also called Diphenylhydantoin and it is a potent…
Q: Illustrate the biosynthetic pathway of resin 2. Give 5 industrial uses of resins
A: Resins : Resins are the amorphous products on complex chemical nature. These are usually…
Q: In size exclusion chromatography, which component will elute last in the set up? O Small proteins…
A: Size exclusion chromatography is a process of separation of molecules based on their size.…
Q: etabolism as a determinant of bioavailability: the first-pass effect
A: Bioavailability is the rate and a particular range of the active ingredient absorption , when it…
Q: Significance of proteins in urine and CSF
A: There are analytical methods and biochemical techniques that can measure proteins in blood, urine,…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: The table below summarizes the results for Xanthoproteic test. Provide the correct remarks from the…
A: Proteins are big, complex molecules that serve a number of important tasks in the human body. They…
Q: With the aid of diagrams describe the signalling pathway involving inositol 1,4,5 trisphosphate from…
A: Membrane phospholipids can act as precursors from which second messengers can be produced during…
Q: What is the approximate temperature (in both F° and C°) for enzyme activity in the human body?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: Loss of function mutation results in a _ allele.
A: Mutations are sudden changes in the gene sequence. When these changes causes loss of function of an…
Q: As observed in the LipidBank database, the lipopolysaccharide referred to as Lipid A from…
A: The cell of a gram positive bacterium is composed of cytoplasm, plasma membrane, cell wall, and a…
Q: BACKGROUND A 2-year-old black girl is being seen by the hematologist after her pediatrician found…
A: Due to the lack of mitochondria, there is no TCA cycle occurring in the RBCs. So, RBCs obtain the…
Q: How many number of histone proteins present in a nucleosome? 4 6 9.
A: The nucleosome is the basic structural unit of DNA packaging in eukaryotes and represents a segment…
Q: Describe the reaction and the products that would occur if transketolase acred upon a pentose aldose…
A: Transketolase is an enzyme of pentose phosphate pathway which accept two carbon from pentose ketose…
Q: normone with its blood concentration inereased during physical
A: Growth Hormone is the hormone which increased with its blood concentration increased during physical…
Q: H1. Estimate the TKN associated with a sample having 50 mg/L of cell tissue and 10 mg/L of ammonia.…
A: TKN (Total Kjeldahl Nitrogen) test is a method of estimation of total concentration of organic…
Q: You are supplied with an unknown protein that consists of more than 130 amino acids. Furthermore…
A: Proteins are the most abundant biomolecule constitutes nearly 75% of the total body weight. Proteins…
Q: An individual developed a condition characterized by progressive muscular weakness and aching muscle…
A: This shuttle functions in the transporting the fatty acids present in the cytosol to the…
Q: Which polymerase transcribes genes with internal control regions (ICR)? ORNA Pol I RNA Pol III RNA…
A: DNA sequences located within the coding region of eukaryotic genes that bind regulatory elements…
Q: a) Which catalytic mechanism occurs in step 2? b) Why must phosphate first bind to succinyl-CoA…
A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Respiration is an oxidative…
Q: Q1. (a) Describe and illustrate each of the following immunoprecipitation techniques (i)…
A: a) Immunoprecipitation (IP) refers to the small-scale affinity purification of antigens with the…
Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…
A: Nucleic acids are constituted of nucleotides linked via phosphodiester linkages while proteins are…
Q: Why people with PK deficiency may tolerate a lower hemoglobin level than people with other types of…
A: Pyruvate kinase deficiency (PKD) is the most prevalent congenital glycolysis enzymatic abnormality…
Q: What are the control mechanisms of glycolysis and the Krebs cycle.
A: The question is all about the process involve in respiration like glycolysis and kreb cycle in which…
Q: Which mayonnaise is thicker? Mixing oil to the mixture gradually or mixing all the ingredients in?…
A: Mayonnaise is a condiment used in burgers, salads, and sandwiches. Mayonnaise is considered as a…
Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…
A: Two answers are correct
Q: On the right the Hill plot com- (b) pares the O2 binding properties of Hb Ya- kima with those of HbA…
A: The Hill plot given in the diagram shows the allosteric regulation and affinity of the different…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Steps in Prokaryotic Translation Initiation: GTP bond Initiation factors (IF1-3) binds to 30S…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: hnRNA is a heterogenous RNA , also called as pre mRNA formed by the enzyme called RNA pol 2 ,…
Q: 8. Which of these is not an example for stereo specificity? a) L-lactate dehydrogenase will act only…
A: Many enzymes can discriminate between enantiomeric substrates and such enzymes exhibit…
Q: Classify the following amino acids base on their side chain if it's either -Non-polar aliphatic R…
A: Amino acids are the molecules that contain an amino group and a carboxylic group linked through the…
Q: 1.Antibiotics that are active against G= and G- organisms such as Blank 1, Blank 2, and Blank 3…
A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have…
Q: What is the detection principle of iodine test for starch
A: The iodine test is a quantitative analysis of carbohydrates to distinguish polysaccharides from…
Q: Why do we prefer to buy products in solid form rather than in a liquid? (i.e., butter or margarine)
A: Introduction - Solid and Liquid form are two of the three basis State s of matter.The solid forms…
Q: How is Pyruvate Kinase Deficiency (PKD) inherited? What gene is responsible for the expression of…
A: Pyruvate kinase is an enzyme that regulates cell metabolism by catalysing the conversion of…
Q: Which of the following viruses have been used as vectors for gene delivery?
A: Gene delivery is a process of introducing the foreign genetic materials which are DNA and RNA into…
Q: D. Lactate
A: Glycolysis is the phenomenon in which sequence of reactions converted glucose to pyruvate and…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: Significance of proteins in CSF and how to determine the cerebrospinal fluid analysis protein.
A: Protein, like the enzymes, blood, and cerebrospinal fluid, may be found in practically all human…
Q: (a) What is a reducing sugar? (b) Give an example of a reducing sugar (c) What test can be used to…
A: a. Reducing sugar:- Any carbohydrate thta reacts with an oxidising agent to form an aldonic acid is…
Q: Thiophene ring contains ------- as heteroatom.
A: Thiophene is a compound with ring structure, in which there will be atoms of two or more different…
Q: 12 If strong-base anion exchange resin is applied to treat raw water with silicate, the pH of raw…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: True or False? It takes Carbon dioxide and water in the presence of sunlight to produce…
A: Carbohydrates are formed in green plants by the process of photosynthesis.
Q: Carbon monoxide is lethal at low concentrations yet it plays an important role in cell signalling…
A: During the breakdown of heme, carbon monoxide (CO) is continually created in mammalian cells. CO is…
Q: 1. Which of the following is not true for the specificity of enzyme action? a) Specificity refers to…
A: Enzymes are proteins that assist the bodies speed up chemical processes. Enzymes are necessary for…
Q: 4. What is a "partially hydrogenated vegetable oil"?
A: Oils are nonpolar, unsaturated lipids that are liquid at room temperature. they are hydrophobic…
97
Step by step
Solved in 2 steps
- Another way how the expression of a gene can exceed the normal pace is if a person has more than one copy of it. There will be a variation or alteration in the gene sequence providing long regulation. Group of answer choices Statement 1 is correct. Statement 2 is incorrect Both statements are incorrect Statement 1 is incorrect, statement 2 is correct Both statements are correctGene expression is required to give cells ________. longevity longevity unique genes unique genes unique specializationsFor each element in the list that follows, indicate whatkind of molecule it is (DNA, RNA, protein, smallmolecule), whether it acts as a positive or negativeregulator, what stage of gene expression it affects, andwhether it acts in cis or in trans. (In its most generalsense, the term cis describes elements that affect the function of the molecule of which it is a part, whiletrans describes elements on one molecule that affectthe function of a different molecule.)a. Lac repressorb. lac operatorc. CRPd. CRP-binding sitee. Trp repressorf. charged tRNATrp (in terms of its function at thetrp operon)g. the antiterminator at the trp operonh. a terminator in the expression platform of ariboswitchi. an sRNA that blocks mRNA translation
- Gene expression can be viewed at which of the following levels?a. Molecular and cellular levelsb. Organism levelc. Population leveld. All of the aboveUse the simple flow chart below to outline the basic procedure of genetic engineering in six steps make sure that your answers are in form of short sentences or clauses with complete thoughtA set of cells that host various DNA fragments collectively representing an organisms entire set of genetic information is called a _______ . a. genome c. genomic library b. clone d. GMO
- In what order does the genetic information flow in living organisms? Choose all that are true. genetic information can be rewritten from protein to DNA genetic information can be translated from RNA to protein genetic information can be rewritten from DNA to RNA genetic information can be rewritten from protein to RNA genetic information can be rewritten from RNA to DNASome mutations or changes in the sequence of DNA, do not have any offect on the characteristics of the organism. Why Is this? The protein from this mutated sequence deactivated by the cell The mutated sequence still codes for the same amino acid The cell recognizes mutations and ignores them when expressing the gene The immune system repairs the mutated sequence during developmentAshanti Silva received the first gene therapy for the treatment of SCID. What do you think, would the combination of gene therapy and stem cell therapy be a better therapeutic option?
- DNA methylation is A. heritable and generally activates gene expression. B. heritable and generally represses gene expression. C. not heritable and generally represses gene expression. D. not heritable and generally activates gene expression.Describe the difference between positive control andnegative control of gene expression.The Number of Protein-Coding Genes in an Organism’s ________ Is Not Directly Related to Its Biological ________ .
