In TCA cycle, FADH2 is formed in reaction(s) catalyzed by a. Succinyl-CoA synthetase b. Succinate dehydrogenase O c. Aconitase O d. Isocitrate dehydrogenase e. Citrate synthase
Q: Respiratory acidosis results from hypoventilation (decreased respiratory rate) causing a decreased…
A: All biological processes are pH dependent. Even a slight change in pH can result in a large change…
Q: The oxidized form of NADH is O NADH+ O NAD+ O NADOH O NADH2 -
A: Metabolism involves the use of many redox reactions. In redox reactions, electrons can either reduce…
Q: The hormone cortisol causes activation of pathways that under normal conditions 4. are not active at…
A: Gluconeogenesis is the synthesis of glucose residues from non-carbohydrate sources such as pyruvate,…
Q: Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose…
A: It makes sense to relate ATP hydrolysis and glucose phosphorylation by increasing the P…
Q: Discuss how each denatures protein.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: provide 3 example pathway of oxaloacetate to other biomolecules.
A: Oxaloacetate is a four-carbon-containing organic compound. It acts as a metabolic intermediate in…
Q: How much ATP would be generated by having one molecule of oxaloacetate being completely oxidized to…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate by…
Q: Given this peptide chain: LYS – MET – ASP – THR – GLN – ARG- LYS – TRP – MET – LYS – GLU – VAL- ARG…
A: Using chromatography, a compound can be separated from a mixture of compounds. There can be various…
Q: How does ATP regulate the activity of PFK-1? ATP binds to PFK-1 at the catalytic site as a…
A: The enzyme phosphofructokinase 1 (PFK-1) catalyzes the following reaction: Fructose 6-P + ATP –>…
Q: Please describe four different modes of the regulation of the pentose phosphate pathway.
A: The pentose phosphate pathway (PPP) is a multienzyme pathway that shares a common starting molecule…
Q: Questions 11-13- refer to the carbohydrate mannose (open chain and one anomeric ring configuration…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Mucic Acid Test for Galactose and Lactose Galactose, on being oxidized with HNO3 forms mucic acid,…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…
Q: Provide the principle of biuret test used to detect RNA. Explain in 5 sentences essay
A: The biuret test is used to detect substances that have peptide linkages. To evaluate the aqueous…
Q: The total degradation of a fatty acid with an odd number of carbons yields acetyl-CoA and another…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 4. The figure below shows ATP in the binding site of pyruvate kinase, an important enzyme in…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Why stachyose can be used as prebiotic??how is the chemical structure of stachyose affect bacteria?
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Eukaryotic RNA polymerase II is used to synthesize: a. rRNA O b. tRNA O C. O d. RNA from viral DNA O…
A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Based solely on the amount of NADPH produced, what is the total number of photons of light that must…
A: In the photosystems, NADPH is produced by a series of reactions starting from absorption of photons.…
Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…
A: Visualising agent: The chemical agents that can be used to detect the number and location of the…
Q: After the first step in the metabolism of amino acids, which of the following statements are true?…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.
A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…
Q: Do carbohydrates and sugars cause weight gain? Explain your answer.
A: Your body receives 4 calories from every gram of carbohydrates. You will gain weight if you consume…
Q: What is the isoelectric point of the following peptide molecule?…
A: The pH at which a specific molecule carries no net electrical charge is known as the isoelectric…
Q: What percentage of Vmax is obtained when the substrate is present at 80% of the KM? Use two digits…
A: Vmax is the maximum velocity attained by an enzyme during a reaction. Km is the substrate…
Q: Which of the following is a second messenger that ultimately causes inhibition of glycogen synthase?
A: Glycogen synthase - is a key enzyme of glycogenesis and also called as UDP- glucosyltransferase. GS…
Q: What is the committed step of pyrimidine biosynthesis? Include the names and structures of any…
A: Pyrimidines are nitrogenous bases found in nucleic acids. Pyrimidines are heterocyclic organic…
Q: a) L-fucose is also known as 6-deoxy-L-galactose. Note that D-galactose is a C-4 epimer of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…
Q: Two villages in the Amazon depend on corn as a major staple in their diet. People in village A have…
A: Pellagra is a deficiency disease which is characterised by diarrhoea, mental disturbance, scaly…
Q: How does alteplase and mannitol affect a laboratory result? Why is it important to inform the lab…
A: Introduction An ischemic stroke is a condition when the blood supply to part of the brain is reduced…
Q: Compare the molecular property of amino acids and their roles in protein folding.
A: There are 20 general proteogenic amino acids (amino acids that are often found in proteins). These…
Q: True or False: Passive-mediated transport proteins lower the delta G of transport to create the…
A: Introduction :- The question is all about transport of molecules by diffusion I. e. Active and…
Q: does BPG bind to deoxyhemoglobin only?why BPG does not bind to oxyhemoglobin? what is chemical…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: 2. Draw the structure of the fatty acid, 16:247,10, as it occurs at pH 7. Make sure double bonds…
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: Consider a situation where a mitochondrion contained a defective complex III that resulted in only…
A: Electron transport chain consists of a series of protein arranged in mitochondria membrane and…
Q: Thermogenin, an electron transport uncoupler protein, is found in large quantities inside the…
A: Thermogenin is an uncoupling protein 1 present in brown adipose tissue. it causes heat generation…
Q: When an inhibitor blocks a step in electron transport, all of the following are true except that Oa.…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: What are the units for KM and why does this constant have these units? In the Michaelis-Menten…
A: The general equation for initial velocity (V) of a reaction involving a single substrate on an…
Q: 1. You order two primers from a company that synthesizes oligonucleotides. The primers have the…
A: Primers are short stretches of nucleotides that are used to initiate the synthesis of nucleic acids.…
Q: A characteristic of complex III is that it is reduced by FADH2. participates in electron transfer…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: 3.5 An a helical, intracellular protein, ITSME, denatures at 80 degrees Celsius. Which of the…
A: Proteins are polymers of amino acid residues linked together via a peptide bond. The amino acid…
Q: what is the mechanism by organophospahtes inbibit enymes?
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Once AMP and GMP are synthesized, they are then converted to ADP and GDP, then to ATP and GDP. What…
A: Adenosine & Guanosine are purine nitrogen bases. To these phosphate groups are attached. AMP…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: 4. Which of the following mutations would most likely keep the transitions of T state to R state in…
A: Amino acids are biomolecules that have a carboxyl group, an amino group and a side group linked to…
Q: What is qualitative analysis of lipids? How important qualitative analysis of lipids in the field of…
A: Lipids are one of the 4 major groups of biomacromolecules. Lipids are a set of biomacromolecules…
Q: The proton gradient across the inner mitochondrial membrane is produced.... by passing electrons to…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Which of the following is 18:248,11?
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Step by step
Solved in 2 steps
- A. What is substrate level phosphorylation. B. Although oxygen does not participate directly in the citric acid cycle , the cycle only operates when oxygen is present. Why is this so so ? C.describe how hibernating animals and new born babies are able to keep warm without shivering. D. What is the metabolic purpose of hexose monophospate shunt pathway E.hg does G6PD deficient individuals have increase in resistance to malaria?The pathway that converts glucose to acetyl-CoA is often referred to as an “aerobic oxidation pathway.” (a) Is molecular boxygen involved in any of the steps of glycolysis? (b) Thinking back to Chapter 20, where does molecular oxygen enter the picture?Which of the following statements about the ß-oxidation cycle is/are TRUE?A. The fatty acyl produced is shorter by 2 carbon atoms than the previous cycle.B. The two oxidation reactions involve both NADH and NADPH.C. Acetyl-CoA is produced in the hydration reaction.D. In the cleavage reaction, the bond between the α- and β- carbons become a double bund.
- Oxidative decarboxylation a. Do not occur in the TCA cycle. b. Involve loss of CO2 and the production of NADH. c. Involve loss of CO2 and the production of NAD. d. Involve loss of CO2 and the production of FADH2.When one acetyl CoA is processed through the citric acid cycle, how many times does each of the following events occur? a. A FAD molecule is a reactant. b. A CoA-SH molecule is produced. c. A dehydrogenase enzyme is needed for the reaction to occur. d. A C5 molecule is produced.During the process of oxidizing palmitate (C16) for fuel, 3-hydroxypalmitoyl CoA __________. Choose ALL that apply. (A) is oxidized by FAD(B) is oxidized by NAD+(C) is a substrate for b-ketothiolase(D) undergoes a hydration(E) is a product of enoyl CoA hydratase(F) is attacked by a CoA molecule to produce acetyl CoA and a C14 acyl CoA
- There are two steps in the TCA cycle that involve the release of free CoA-SH. However, only one of these steps is regulated (i.e. only one of the steps has a large negative delta G). Explain why one of these CoA-SH releasing steps is highly thermodynamically favorable while the other is not.Which of the following stimulates the conversion of pyruvate to acetyl-CoA? a) Activation of pyruvate dehydrogenase kinase b) A decrease in the ratio of NAD+/NADH c) Bothaandb d) Neither a nor bIf you fed a mouse a diet made up of exclusively Leucine, the mouse would eventually: A、Undergo extensive gluconeogenesis B、Enter ketosis C、Have a buildup of α-Ketoglutarate D、gain weight E、have a buildup of succinyl-CoA
- myristic acid (14:0) to carbon dioxide and watera. rounds of the beta oxidation pathway will be involvedb. how many moles of acetyl CoA will be produced after complete beta oxidationc. how many moles of ATP will be obtained after complete beta oxidationPharmaceuticals in a class called the statins inhibit theenzyme HMG-CoA reductase. What is the primary effect ofthis drug on patients?The metabolic function of the pentose phosphate pathway is to: a. generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. b. provide intermediates for the citric acid cycle c. participate in oxidation-reduction reactions during the formation of H,O d. act as a source of ADP for biosynthesis