In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR gene is described as 583 AC (deletion of 1 nucleotide at position +583). At the protein level, the mutation would be described as: a. a nonsense b. a missense c.

In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR gene is described as 583 AC (deletion of 1 nucleotide at position +583). At the protein level, the mutation would be described as: a. a nonsense b. a missense c.

Name: In the human enzyme encoded by the DCXRgene, a mutation in the protei
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: In the human enzyme encoded by the DCXRgene, a mutation in the protein coding regionof the DCXR gene is described as 583 AC(deletion of 1 nucleotide at position +583). Atthe protein level, the mutation would bedescribed as: a. a nonsense b. a missen

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?
Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
A nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain (b) results from the deletion of one or two bases, leading to a shift in the reading frame (c) results from the insertion of one or two bases, leading to a shift in the reading frame (d) results from theinsertion of a transposon (e) usually results in the formation of an abnormally short polypeptide chain
Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?
The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…
In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give rise to an mRNA for protein A and the other DNA strand is transcribed to give rise to an mRNA for protein B. a) Would there be any problem in expressing the two genes? 2. b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?
Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of the manyways previously described is a loss-of-function _______?
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region (the coding sequences), and a 3′ UTR.a. What important sequences required to controlhunchback gene expression are found in the transcriptional regulatory region of hunchback?b. What sequence elements that encode specific protein domains are found in the structural region ofhunchback?c. Another important kind of sequence is located inthe 3′ UTR of the hunchback mRNA. What mightthis sequence do?
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′