Are these answers correct? It's all for one problem where the E. coli chromosome contains 4,641,652 bp. In the replication of the E. coli chromosome, about how many Okazaki fragments would be formed? Assume the averageOkazaki fragment is 1,500 nucleotides long.number of Okazaki fragments: 3094What factors are required to link together newly synthesized Okazaki fragments in the lagging strand?DNA ligaseDnaG proteinDNA polymerase ISingle-stranded DNA-binding protein (SSB)DNA polymerase III O Macmillan LearningThe E. coli chromosome contains 4,641,652 bp.How many turns of the double helix must be unwound during replication of the E. coli chromosome?number of turns: 4.42 x105How long would it take (in minutes) to replicate the E. coli chromosome at 37 °C if two replication forks proceeded from theorigin? Assume replication occurs at a rate of 1,000 bp/s.replication time: 39Under some conditions E. coli cells can divide every 20 min. How might this be possible?A new round of replication begins before the previous one is completed.The chromosome has two origins, each proceeding bidirectionally to yield four replication forks.E. coli cells use multiple types of DNA polymerases to replicate the chromosome.E. coli cells do not replicate their genome before dividing.min

Prokaryotes have evolved to contain simple genomes. Thus, they are more efficient in replicating…

In the replication of the E. coli chromosome, about how many Okazaki fragments would be formed? Assume the average Okazaki fragment is 1,500 nucleotides long. number of Okazaki fragments: 3094 What factors are required to link together newly synthesized Okazaki fragments in the lagging strand? DNA ligase DnaG protein DNA polymerase I Single-stranded DNA-binding protein (SSB) DNA polymerase III

In the replication of the E. coli chromosome, about how many Okazaki fragments would be formed? Assume the average Okazaki fragment is 1,500 nucleotides long. number of Okazaki fragments: 3094 What factors are required to link together newly synthesized Okazaki fragments in the lagging strand? DNA ligase DnaG protein DNA polymerase I Single-stranded DNA-binding protein (SSB) DNA polymerase III

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 4P: Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram...

See similar textbooks

Similar questions

Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.
4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication (you must accurately describe the differences between the two - an accurate statement about one form of replication that does not clearly indicate how the other form differs will not answer the qestion in it's entirety).
Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
Which statements are true? Explain why or why not.1 The different cells in your body rarely havegenomes with the identical nucleotide sequence.2 In E. coli, where the replication fork travels at 500nucleotide pairs per second, the DNA ahead of the fork—in the absence of topoisomerase—would have to rotate atnearly 3000 revolutions per minute.3 In a replication bubble, the same parental DNAstrand serves as the template strand for leading-strandsynthesis in one replication fork and as the template forlagging-strand synthesis in the other fork.4 When bidirectional replication forks from adja-cent origins meet, a leading strand always runs into a lag-ging strand.5 DNA repair mechanisms all depend on the exis-tence of two copies of the genetic information, one in eachof the two homologous chromosomes
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
How did Meselson and Stahl support Watson and Crick’s double-helix model? They demonstrated that each strand serves as a template tor synthesizing a new strand of DNA They showed that the DNA strands break and recombine without losing genetic material They proved that DNA maintains a doublehelix structure while undergoing semiconservative replication They demonstrated that conservative replication maintains the complementary base pairing of each DNA helix.
Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
Watch this video (http://openstaxcollege.org/l/DNArep) to learn about DNA replication. DNA replication proceeds simultaneously at several sites on the same molecule. What separates the base pair at the start of DNA replication?
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?