In TLC, point of origin refers toThe bottom edge of the TLC plateO The spot where the chemical has moved to after the TLC runO The highest point on the plate to which the solvent has traveledO The spot where the chemical is placed on a TLC plate before the TLC run Which of the following functional groups is NOT present in aspirin molecule?O ester groupO carboxylic acid groupO benzene ring (aromatic group)phenol group

Question 1: Option 1 is the correct answer. The point of origin was sketched very lightly with…

Answered: In TLC, point of origin refers to O The…

Science

Chemistry

In TLC, point of origin refers to O The bhottom edge of the TLC plnto.

Macroscale and Microscale Organic Experiments

7th Edition

ISBN:9781305577190

Author:Kenneth L. Williamson, Katherine M. Masters

Publisher:Kenneth L. Williamson, Katherine M. Masters

Chapter4: Recrystallization

Section: Chapter Questions

Problem 6Q

See similar textbooks

Related questions

Q: Which of the following factors DOES NOT affect retention time of a sample undergoing normal phase…

Q: Calculate the Re value for a spot in a TLC experiment if the solvent moved 14.5 cm and the spot…

A: Given Distance moved by solvent = 14.5 cm Spot of Compound moved from the origin = 6.1 cm Rf =…

Q: The obtained plot in the detector of HPLC is called, O peak O bell O triangle area

A: HPLC stands for high performance liquid chromatography which is a separation technique and the…

Q: What is 2D gel electrophoresis

A: 2D gel electrophoresis is a technique for detection and separation of proteins. It is a combination…

Q: Show TWO (2) characteristics of the core enhanced technology that contribute to better separations,…

A: A question based on analytical separations that is to be accomplished.

Q: Which is better HPLC system Agilent 1290 Infinity II LC or Nexera Series UHPLC? Explain

A: HPLC is High Performance Liquid Chromatography UHPLC is Ultra High Performance Liquid Chromatography

Q: The following data were obtained by GC on a 40 cm packed column. ( VM: 1.28 mL, Vs: 0.65 mL)…

A: Solution:

Q: How to improve the sensitivity and selectivity of AFS for Hg detection? Please explain.

A: If we increase the intensity of excitation source in AFS , high sensitivity will be…

Q: Which technique measures secondary structure? a. Size exclusion chromatography b. Circular Dichroism…

A: The secondary structure is formed by bending of the 1o structure. In this, an intermolecular force…

Q: C. >) Order the compound A, B and C from lowest to highest Rr. The sample is spotted on a silica gel…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: 12. This detector is not used in HPLC: a) ECD b) MS c) Fluorescence d) RI

A: Mixture components are estimated using HPLC detectors. The actual separation in HPLC (High…

Q: What would happen to the retention time of a compound if the followingchanges were made?a. Decrease…

A: Chromatography is the technique to separate components of a mixture.

Q: Explain in detail how we optimize chromatographic seperations?

A: Solution The contribution is geared toward the event of methodology that permits to contemplate…

Q: Define the following terms used in HPLC: (a) gradient elution (b)…

A: Given terms, (a) gradient elution (b) isocratic elution (c) reversed-phase packing

Q: How does the wavelength in chromatogram affect the signal intensity in an HPLC

A: wavelength in chromatogram affect the signal intensity in an HPLC explanation is given below.

Q: columns of equal length (time in min). Column 1 Column 2 10 suodsa opaad

A: Answer. For Component A we have 8-1.2 = 6.8

Q: ) In What order Ufrom highest Rf tolanest Rf) wonld you edpeet to fina 3 compardy Shopn below on a…

Q: For GC analysis, the following can cause band broadening and poor resolution OUse of automatic…

A: Chromatography is separating technique for mixtures into it's components. It is based on the…

Q: What are the advantages of using a multidimensional HPLC separation for the analysis of complex…

A: Since you have asked multiple questions, we will solve the first one for you. For remaining…

Q: ii) What are the adjusted retention times for components A and B? iv) What is the relative retention…

A: 3 . For component A = 8-1.2=6.8 For component B = 10-1.2 = 8.8 4. Separation factor = 1.29

Q: Sort the following molecules in order of increasing Rf value assuming a normal-phase silica TLC…

A: Here, TLC plate was used with a 10 : 1 hexane:ethyl acetate solvent system which is non-polar.…

Q: What happen to the separation raid (RS) in HPLC if I change the mobile phase from methanol/water…

A: Given: We have to tell the effect of polarity on the separation rate in HPLC.

Q: 1. Please explain the difference between parallel and antiparallel B sheet. Which one has tp…

A: As per the guide line, Since you have asked multiple questions, we have solved the first question…

Q: what are advangtage and disadvantage of using an Atomic Force Microscopy and explain each

A: Atomic force microscopy is a technique by which we study the different type of surfaces like…

Q: List the desirable characteristics of HPLC detectors.

Q: What is the application of chromatography (HPLC) and it's mechanism ?

A: Answer.

Q: could products be isolated for further analysis suing TLC (thin-layer chromotography) as a…

A: Chromatography is a laboratory technique for the separation of a mixture into its components. The…

Q: The total retention time of dodecane on a 15 m x 0.25 mm i.d. DB-5 GC column was 8.0 min. The column…

A: Given: Number of theoretical plates=N=25600Retention time=tR=8.0 min

Q: the efficiency of a chromatographic column improves the measure that a.increases the height of the…

A: To determine what improves the efficiency of a chromatographic column:

Q: Question attached

A: Chromatography is a technique that is used to separate components of mixture.

Q: What is the retention factor of a sample when after injectiion the void time (tM) took 4.18 sec? The…

Q: state/hexane, the sample showed a single spot at 3.4 cm (relative to vent had risen to 7.1 cm…

A: TLC ( thin layer chromatography) is the technique used in chemistry laboratories to identify the…

Q: Compare gradient and isocratic mode in HPLC.

A: Gradient and isocratic mode in HPLC are the two different modes of operating condition in HPLC.

Q: or non provid- a) PCI- c) OF

A: This question is related to Lewis structure.

Q: How can you ensure “good quality” peak separation in high performance liquid chromatography (HPLC)?

A: In HPLC , different kind of columns are used to separate to isomers. So, here by using trial method…

Q: In thin layer chromatography, changing the mobile phase will alter the Rf value of a compound. O…

A: This can be solved as follows

Q: Two components in an HPLC separation have retention times that differ by 15 s. The first peak elutes…

A: The base number of hypothetical plates under given conditions ought to be resolved to utilize the…

Q: what chromatography seperation how is tlc part of it

Q: Which is NOT a factor that affects retention time? I. the pressure used II. The nature of the…

A: the retention time will vary depending on: the pressure used (because that affects the flow rate…

Q: Different from GCMS, why is an interface needed when coupling HPLC with MS?

A: In addition to the liquid chromatography and mass spectrometry devices, an LC-MS system contains an…

Q: Calculate the Rf value of the Blue spot on the TLC Plate below. (answer must have * 2 decimal…

A: Calculate Rf value of the blue spot on TLC. From the figure, Distance travelled by the solvent…

Q: What is the retention factor of a sample when after injectiion the void time (tM) took 4.73 sec? The…

A: Answer: Retention factor is equal to the ratio of difference (between retention time and void time)…

Q: which of the folowing(s) is/are true ? 1 split ratio in GC is a ratio of sample passed to column…

A: Column resolution increases with increase in length and decrease in diameter.

Q: UVVIS spectrophotometry

A: Correct: A

Q: Please describe possible sources of error in HPLC experiments - systematic and random and how they…

A: HPLC(High performance liquid chromatography) Errors in HPLC can be systematic and random. Systematic…

Q: in high preformance liquied chromarography, what is a Bi phenyl , and what its application and…

A: Generally, C18 columns offer the ability to resolve a wide variety of analytes without issue.…

Question

In TLC, point of origin refers to
The bottom edge of the TLC plate
O The spot where the chemical has moved to after the TLC run
O The highest point on the plate to which the solvent has traveled
O The spot where the chemical is placed on a TLC plate before the TLC run

Which of the following functional groups is NOT present in aspirin molecule?
O ester group
O carboxylic acid group
O benzene ring (aromatic group)
phenol group

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Question 1

VIEW

Step 2 Question 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

Aside from TLC and paper chromatography, what are the other types of chromatography. Discuss their principles, applications and limitations.
A sample of fried potatoes weighing 200 g was extracted using a volatile organicsolvent. The recovered cooking oil weighed 15 g. What methods from thisexperiment could be used to separate the cooking oil after the extraction? (evaporation, gravity filtration or vacuum filtration?) why so?
Name 3 adsorbents used in TLC. Mention their use and properties. Why is it important to use a pencil, and not pen, for marking TLC plates?
Which of the following are necessary steps in performing paper chromatography? I. Saturate the chamber with the vapor of the mobile phase II. Allow the chromatogram to touch the sides of the beaker III. Place the spots at the same height as the solvents IV. Spot the samples 2 cm apart from each other a. I and IIIb. I and IVc. I, III and IVd. II, III and IV
Which of the following chromatographic methods cannot use a mixture of liquid solvents (eluents) during the separation process? Thin layer chromatography High pressure liquid chromatography Column chromatography Gas chromatography
Which is more accurate, a transfer pipet or a measuring pipet? What is theuncertainty in microliters when you deliver either 10 mL or 100 mL from a 100-mL adjustable micropipet?
2. a) What is a bonded phase in HPLC?b) Give an example of a bonded phase in reversed-phase liquid chromatography and normal phase liquid chromatography.c) Describe when you would choose to use a reversed-phase column or a normal-phase column for an analysis of a mixture.
What types of flow meters are used in gas chromatography?
Which of the following is NOT correctly related to the parts of paper chromatography set-up? a. Mobile phase: solvent b. Solute/Mixture: extract c. Stationary phase: paper d. Chromatographic chamber: sealed container
Use a chemical dictionary, chemical text or encyclopedia to find a specific definition of "chromatography." List a few mobile and stationary phases.
Which of the following could be a consequence of an open and uncovered chromatographic chamber? I. The travel rate of a component would be faster. II. The chromatographic chamber will not be saturated. III. The mobile phase will take a longer time to reach the end line. Select one: a. I, II, and III b. I only c. I and III d. II and III
A piece of filter paper is placed in the TLC developing chamber to: Choose one: provide a lining for the TLC plate to rest on. help the chamber saturate with the developing solvent's vapor. make it easier to visualize the solvent front level. protect the TLC plate.