Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clear handwritten answer in 2 figures)

Q: Question 16 Prepreg material has the O the matrix by itself. The fibres are added later. O fibres…

A: A multiple choice question based on polymer chemistry, which is to be accomplished.

Q: Use the values provided below to calculate the predicted isoelectric point, pl, value for aspartame…

A: Isoelectric point:  Isoelectric point of a amino acid is the pH at which amino acid has a neutral…

Q: XI. Compare and contrast the following protein characterization techniques in terms of the…

A: The solution of the question is given below:  “Since you have posted a question with multiple…

Q: Calculate the following DNA concentrations and determine the purity of the samples: DNA Dilution…

A: Formula used :-  Concentration of double stranded DNA = 50 µg/mL × OD260 × dilution factor.

Q: Protein characterization Parameter molecular weight amino acid sequence native structure bioactivity…

A:

Q: a-helix B-pleated sheet H. OHH OHH R HH -NCC-Ncc H ÖH H OHH %3D %3D HHO 3D %3D H H %3D 3D HHO HIGIR

A: Amino acid is the building block of protein. Protein has four kinds of structure i.e. primary,…

Q: Given below is a sequence of DNA. Complete its complementary strand. 5’ AGCCCTGACGTGCCAGT 3’

A: Base complementary rules:  Adenine pairs with Thymine Guanine pairs with Cytosine Cytosine pairs…

Q: This technique uses the principle of isoelectric point to separate a mixture of proteins into its…

A:

Q: 1. Write the expression for Ksp for a. Ag2CrO4     b. Ca3(PO4)2

A:

Q: viii) You have the following stock solutions available: 2.5M Tris, 0.5M Glycine and 10% SDS, how…

A: To prepare 1 liter solution of 25mM tris, 190mM glycine and 0.1% SDS can be prepared by following.

Q: 5 ased on molecular weights of purified (no beta-Me) and (beta-Me) sample, which are 97.4 kDa and…

A: Given , molecular weight of (no beta -Me ) purified sample = 97.4 kDa molecular weight of (beta -Me)…

Q: Most ring fusions in a steroid molecule are: Cis Parallel Trans Anti

A: Steroid molecules generally have a four fused cycloalkane rings. For example cholesterol.

Q: Describe the tertiary and quaternarystructure of a protein.

A: Proteins are made up of long chains of amino acids. These amino acids are known as the monomers of…

Q: Estimate the isoelectric point of a Ser–His dipeptide. Explain why this value is only an estimate.

A: The ionizable group of serine at neutral pH is an amino group and its ionization constant is pK2 =…

Q: If you heat a protein to break the intramolecular hydrogen bonds, will you maintainthe α- helical or…

A: Proteins are the polymers of amino acids. They first form linear chain of amino acids called primary…

Q: pinds to the active site of an enzyme clows the reaction down at low substrat

A: A competitive inhibitor binds to the active site of an enzyme.

Q: Find the isoelectric and zwitter ion of lysine

A: isoelectric point means the characteristic pH at which net effective charge of an amino acid is…

Q: What have you discovered or learned about IMFs? State the IMF trends.

A: To explain: The IMFs. IMFs or intermolecular forces are weak forces of attraction that is present…

Q: Assume the energy of hydrogen bonds per base pair to be 10 kJ mol-1. Given two complementary strands…

A: Given data: energy of hydrogen bond per base pair = 10 kJ; Temperature, T = 300 K Ratio of separated…

Q: Answer Q21, 22, 23

A: 21. Third statement is not correct. [Zn(NH3)4]+2  is sp3 hybridized. Vanadium has 5 valence…

Q: Define homologous series?

A: The group of organic compounds that can be expressed by the same general formula having the same…

Q: Classify attached radical as 1°, 2°, or 3°.

A: The type of radicals can be identified as

Q: The negative ion mode electrospray ionization (ESI) mass spectrum of an oligonucleotide shows peaks…

A:

Q: Which of the following statements are correct about the process of protein structure determination…

A: Proteins are the building blocks of life which are composed of amino acids and these are arranged…

Q: . Polyglycine, a simple polypeptide, can form a helix with 6 = -80°, ự = +150°. From the…

A: In Ramchandran Plot (φ) represent Phi (ψ) represent psi - Dihydral angle  - dihydral angle is the…

Q: Given the following peptideSEPIMAPVEYPK(a) Estimate the net charge at pH 7 and at pH 12. Assume the…

A:

Q: justify the ingridients of benadryl cream

A: The Benadryl cream is actually an itch stopping cream. It is used to relieve itching and pain…

Q: dentity the predominate attractive force responsible for the proteins tertiary structure at the…

A:

Q: When the relaxivity of a Gd-based magnetic resonance agent is high, this means that slight changes…

A: The given statement is False. Slight changes in Gd concentration will result into big changes in…

Q: 4

A: DNA strands are negatively charged so, they are attracted by the positive electrode. In gel…

Q: Question 1. a) Describe the effect of conjugated chromophores in a molecules UV-Vis absorption.

A: Conjugation is the system in which one single bond is combined to one double in a long chain. Or…

Q: Proteins A, B, and C have isoelctric points of 8.2, 6.7,  and 5.2 respectively.  Place proteins A,…

A: The heavy molecules travel shorter distance whereas light molecules travel larger distance under the…

Q: What type of interaction holds a-helices and B-pleated sheets together? A) dispersion forces B)…

A:

Q: _has emerged as a technique for protein sequencing. Select an answer and submit. For keyboard…

A: Given: Protein sequencing  To find: Technique for protein sequencing Solution: Proteins are made up…

Q: which of these four amino aid& could not rotate ithe plane of plane- folarised light? NCHECHSH)(O0H…

A:

Q: Ph PHHC-PPH3

A:

Q: The following table shows the distance moved in an SDS-polyacrylamide gel by a series of marker…

A: Given:

Q: This technique uses the principle of isoelectric point to separate a mixture of proteins into its…

A: 1. Electrophoresis : Neutral amino acid contains one -COOH and one -NH2 groups. Hence, they exist as…

Q: 1. How does real-time polymerase chain reaction work?  2. What does the melting point represent?

A: Real-time polymerase chain reaction This is also commonly known as RT PCR. It is a laboratory…

Q: Match the region A,B,C. Question 4 Below is the structure of a hypothetical photo-affinity probe…

A: 1. Cross-links with nearby proteins in the presence of UV light The answers is B.

Q: Although the bond energy for the hydrogen bond in a vacuum is estimated to be about 20 kJ/mol, we…

A: In order to solve this question, we must have some idea regarding the proteins nature and when it…

Q: D Question 9 By what physical property of the protein does SDS-PAGE technique separate different…

A: The first thing to know about how SDS-PAGE works is that it separates proteins according to their…

Q: Below which is false about determining protein three-dimensional structure?

A: X-ray crystallography is a non-destructive method to determine the crystal information of any pure…

Q: Are the other polytypes 1H and 3R of PtX2 have been investigated?

A:

Q: In SDS page, the elute from the column first. proteins will move through the gel fastest and first,…

A: SDS page and size exclusion chromatography are methods to separate proteins . In SDS page, charged…

Q: [NO]fîinal %3D

A:

Micelles and Biological Membrane

Micelles are the type of lipid molecules that organize themselves in spherical shape in aqueous solutions. The production of the micelle is a reply to the amphipathic behavior of fatty acids. It means that they consist of both hydrophobic regions and hydrophilic regions. In micelles, polar head groups (hydrophilic groups) produce an outer layer associated with water whereas nonpolar tails (hydrophobic groups) are organized in the interior.