In which site in the cell does a radiolabeled secretory protein first appear when tissue is incubated briefly with radioactive amino acids? a. SER b. Golgi apparatus c. RER d. secretory vesicles e. nucleus

In which site in the cell does a radiolabeled secretory protein first appear when tissue is incubated briefly with radioactive amino acids? a. SER b. Golgi apparatus c. RER d. secretory vesicles e. nucleus

Body Structures & Functions

12th Edition

ISBN:9781285695495

Author:Scott

Publisher:Scott

Chapter3: Cells

Section: Chapter Questions

Problem 4RQ

See similar textbooks

Related questions

Q: mimicry? followin an example of a snapping turtle that uses its tongue to mimic a worm, thus…

A: Mimicry is the adopting behaviour of organisms. One organism behaves like other organisms or…

Q: he impulse travels

A: The impulse in the heart travels in a specific order to coordinate the contraction and relaxation of…

Q: 7. (a) Present the Monod equation in the given space below and define each of the terms (e.g., μmax,…

A: The Monod equation is a mathematical model that describes the growth rate of microorganisms as a…

Q: It’s late summer and a new influenza virus strain has appeared in chickens across the country. It’s…

A: I would analyze the genetic sequence of the new strain and compare it to the key mutations…

Q: You are analyzing the intracellular DNA intermediates formed during the replication of the…

A: The provided experimental results involve the analysis of DNA intermediates in wild-type and mutant…

Q: What is a loading buffer and how does it function? What does 10x loading buffer mean?

A: Gel electrophoresis is a technique extensively used in molecular biology research to separate and…

Q: Part A Drag the labels onto the diagram to identify the structural elements of a DNA molecule.…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of two…

Q: Please expound your answer. If you'll write, please do it legibly and clearly. Thank you. Explain…

A: Friedrich Wohler, a German scientist, accidentally created urea in the lab by employing the…

Q: If we cross a pure red-eyed female rat with a white-eyed male rat, what is the expected ratio of…

A: The red trait is encoded by the gene present on X chromosome. The XR allele encodes red color and it…

Q: give pictures and Identify and label the parts of trachea, lung, larynx, bronchiole and epiglottis…

A: The human respiratory system does the gas exchange in the body. It consists of several organs such…

Q: What is the relationship between dilution factors and the efficacy of antimicrobial agents in…

A: The relationship between dilution factors and the efficacy of antimicrobial agents refers to the…

Q: Bacteriophage P22 was used in generalised transduction experiments to infect the Salmonella…

A: The horizontal transfer of the genetic material from donor bacteria to the recipient bacteria via…

Q: Ryanodine Receptor (RyR) SERCA (SR Ca2+ ATPase) Voltage-gated Na+ channels Actin Myosin…

A: The excitation-contraction coupling process refers to the sequence of events that links the…

Q: Question 1 Interpret why halophilic lactic acid bacteria (HLAB) isolated from environmental samples…

A: Humans have incorporated fermented foods into their diets because of their multiple health…

Q: What role do microbial symbionts play in shaping the ecological interactions between plants and…

A: Microbial symbionts are microscopic organisms, such as bacteria, fungi, and viruses, that maintain a…

Q: e fluorescent label in this image is he cell shapes are imaged with The microscopy used for…

A: In the image given some kind of cells are present which are glowing. Some cellular processes are…

Q: Examining the following peptide sequence, it is determined to be phosphorylated. -WQRYGLK- Which…

A: Amino acids are made up of carbon, hydrogen, oxygen, and nitrogen. The standard amino acids are…

Q: 4. Which of the following statements are correct? A. Signalling molecules that are lipid-soluble…

A: Lipid-soluble signaling molecules, such as steroid hormones, can diffuse across the cell membrane…

Q: Your mission: ❖ Illustrate (that means draw) the crime scene, indicating where all the witnesses…

A: Photosynthesis is a process by which green plants prepare their food with the help of carbon…

Q: Briefly explain the rationale for deciding on sample size for a population study. Identify Three…

A: Due to practical constraints including time, money, and resources, it is frequently difficult for…

Q: Suppose a positive Barfoed's test was obtained with sucrose solution suggest and 2-3 sentence…

A: Sucrose is a disaccharide. It is formed from the dehydration reaction of glucose and fructose…

Q: Where do the major checkpoints occur in the cell cycle? A. G1, S and G2 B. G1, G2 and M C. G1 and S…

A: During the cell cycle there are specific checkpoints that ensure the proper progression and…

Q: What is water saturated phenol and what is its function in RNA extraction?

A: Water-saturated phenol, commonly known as phenol:chloroform:isoamyl alcohol (25:24:1), is a vital…

Q: onosaccharides are simple sugars composed of what saccharide molecule

A: The unit structure of carbohydrates is generally known as the saccharide. Saccharides are the…

Q: Epiphytic plants grow on top of trees, without harming them. They obtain water and nutrients from…

A: commensalism is type of relationship in between the individuals of two species in which one species…

Q: Would a chemical that interacts with Ftsl, preventing these proteins from functioning, make a good…

A: Antibiotics will be used to treat bacterial diseases. But the spread of antibiotic resistance poses…

Q: Which of the following is the primary function of carbohydrates in living organisms? Multiple Choice…

A: Carbohydrates are a class of biomolecules consisting of carbon, hydrogen, and oxygen atoms, with a…

Q: A mixture of amino acid lysine, alanine, aspartic acid is subjected to an anionic exchanger…

A: In anion exchange chromatography, molecules can be separated based on their charge properties. It is…

Q: Draw and label a lophophore and describe how it works in suspension feeding. What three phyla…

A: Lophophorates are organisms having mouths surrounded by tentacles. These tentacles are called…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: Give typing answer with explanation and conclusion A biologist is measuring photosynthesis and…

A: NPP stands for Net Primary Productivity. It is the rate at which primary producers, such as plants…

Q: What is the advantage in using LSTB in the presumptive test for the presence of coliforms?

A: LSTB has selective properties that favor the growth of coliform bacteria while inhibiting the growth…

Q: A molecule that is oxidized... a) captures light energy Ob) accepts electrons Oc) reacts only with…

A: Oxidation is a chemical process in which involves the loss of electrons from a substance. A…

Q: A study was conducted to determine the importance of Nucleoid Associated Proteins (NAPs) by deleting…

A: 1- Nucleoid-associated protein (NAPs): These are small DNA binding proteins which can alter the DNA…

Q: What is the common goal of the nervous and endocrine systems?

A: Nervous system is responsible for coordinating the different body parts. It includes brain and…

Q: 19. If a scientist administers an electrical stimulation to a neuronal cell the most likely results…

A: Neuronal cells have specialized proteins called ion channels embedded in their cell membranes. These…

Q: Enhancers promoters changing transcription potential insulator sequence translation distant the same…

A: 1. Enhancers can regulate genes from a distance, and yet they influence expression of only some…

Q: ✓ Treatment with high concentrations of micrococcal nuclease (Mnase) ✓ Low Salt ✓ Absence of Histone…

A: Eukaryotic DNA (except in dinoflagellates) remain associated with histone protein and form a…

Q: You are required to design a carbon-based, eukaryotic, unicellular organism that contains…

A: A unicellular eukaryotic cell is the most basic form of eukaryotic life. Unicellular eukaryotic…

Q: 15. In the ETC shown below, explain, IN YOUR OWN WORDS, what is occurring at the different stages…

A: The electron transport chain (ETC) is a series of protein complexes that are embedded in the inner…

Q: What is biology

A: Science is defined as any defined knowledge system that deals with the physical world and its…

Q: Match each statement about a microorganism to its most appropriate metabolic type. A microorganism…

A: There are energy sources for many microorganisms. They require energy for carrying out their various…

Q: 5. Consider mitotic division. In which phase do kinetochore-microtubules depolymerize? A. Metaphase…

A: Mitosis is the division of one parent cell into two identical daughter cells with a complete set of…

Q: Consider why there might be natural selection for poisonous plants to warn potential herbivores with…

A: In plants the above-ground structures such as leaves and flowers are vital for photosynthesis and…

Q: Identify and compare the histology of the different structures of the respiratory system; and to…

A: Respiratory system consists of the organs and other body parts that involves in breathing process.…

Q: There are five spicule specimens, identify the specific type of spicule

A: Spicules are the skeleton which can be calcareous or siliceous or fibers composed of spongin that…

Q: Please answer this question correctly: True or False: The traits of individuals who survive the…

A: Traits refer to observable and measurable characteristics or features of an organism. They can…

Q: i. Explain the behaviour of the amino acids (Alanine, Lysine, aspartic acid) during the ion exchange…

A: In column chromatography the elution process involves passing a sample through a column packed with…

Q: Briefly discuss how the following may determine the type of statistical analysis to be applied in…

A: An empirical study is a type of research that is based on empirical evidence gathered through…

Q: Create a dichotomous key using the genera/species: Mycale laxissima, Halichondria poa, Amphimedon…

A: A dichotomous key is a tool used in taxonomy and biological classification to identify and classify…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

23. In which site in the cell does a radiolabeled secretory protein first appear when tissue is incubated briefly with radioactive amino acids?

a. SER

b. Golgi apparatus

c. RER

d. secretory vesicles

e. nucleus

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: introduction

VIEW

Step 2: Explanation

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

6. A researcher isolates and collects a particular cell membrane protein and injects a pure solution of these proteins into a laboratory animal. The laboratory animal most likely ______. A. incorporates the proteins into its own cell membranes B. digests the proteins as a food source C. produces antibodies that bind specifically to that membrane protein D. goes into shock and die
The Golgi complex functions to A) modify and secrete proteins to the external environment. B) sort proteins used within the cell. C) both modify and sort proteins into those destined for secretion and those that function in membrane structures. D) synthesize proteins.
100. Hemocytes are stem cells which become plasma cells of the White Blood Cell System. These cells produce a type of proteins called antibodies. These antibodies attack viruses and bacteria. Such cell products are: a) synthesized by the ribosomes, b) synthesized into the endoplasmic reticulum, c) transported by vesicles into the Golgi apparatus, d) released by the Golgi apparatus into the blood by exocytosis e) all of these steps occur.
41. Many secretory proteins are synthesized as inactive precursors called a. proproteins b. secretomes c. chaperons d. glycoproteins e. exosomes
1.Hemocytes are stem cells which become Red Blood Cells (RBC). The RBCs are filled with a protein called hemoglobin. Such a cell product is stored in cell structures that are: a) formed from the nucleus, b) formed from as vesicles from the endoplasmic reticulum, c) engulfed into the cell by pinocytosis, d) released into the blood by exocytosis e) ingested by phagocytosis. 2.The Prokaryotes are associated with the following structures EXCEPT: A) ribosomes, B) Lysosomes and liposomes, C) a nucleoid area, D) mesosomes, E) chlorophyll. 3. In the evolution of cell specialization, the molecule ATP is important because it: a) supplies energy needed to synthesize macromolecules within the cell. b) supplies energy required to pump substances across the plasma membranes. c) is the energy source for muscles to contract. d) All of the choices are correct. e) None are correct 4. Which of the following exhibits embryonic development by the protostome pathway? a) mollusk, b) sharks, c) amphibians,…
Which pathway supplies materials to lysosomes and is used to degrade obsolete parts of the cell? a. Phagocytosis b. Autophagy c. Apoptosis d. Necrosis e. Endocytosis
FtsZ proteins direct the formation of a ________ that will eventually form the new cell walls of the daughter cells. a. contractile ring b. cell plate c. cytoskeleton d. septum
Which of the following statements about proteins is correct? a. Proteins are transported to the rough ER for use within the cell. b. Lipids and carbohydrates are added to proteins by the Golgi complex. c. Proteins are transported directly into the cytosol for secretion from the cell. d. Proteins that are to be stored by the cell are moved to the rough ER. e. Proteins are synthesized in vesicles.
What controls the passage of molecules into and out of the nucleus? a. endoplasmic reticulum, an extension of the nucleus b. nuclear pores, which consists of membrane proteins c. nucleoli, in which ribosome subunits are made d. dynamically assembled microtubules e. tight junctions
Expalin the difference between cytosol and cytoplasm in both prokaryotes and eukaryotes.
One is true about smooth endoplasmic reticulum A. It lacks ribosomes B. It is site of Ca2+ sequestration C. It is involved in detoxification of organic molecules D. It is th site of steroid hormone synthesizes E. It is the site of protein synthesis
How do proteins get to the Golgi body? A. They are translated directly into the Golgi body B. They are transported there by other proteins C. They are transported in a vesicle D. They move directly from the ER to the Golgi because they are connected continuously