Label each true or false A.STTGATA3 is the consensus sequence of the -35 regulatory region of prokaryotic genes B. The chromosomes in the image to the right illustrate a reciprocal translocation: (picture) C. When histones are deacetylated, nucleosomes transcription is repressed.

Label each true or false A.STTGATA3 is the consensus sequence of the -35 regulatory region of prokaryotic genes B. The chromosomes in the image to the right illustrate a reciprocal translocation: (picture) C. When histones are deacetylated, nucleosomes transcription is repressed.

Name: Label each true or false A.STTGATA3 is the consensus sequence of the -
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Label each true or false A.STTGATA3 is the consensus sequence of the -35 regulatory region ofprokaryotic genesB. The chromosomes in the image to the right illustrate areciprocal translocation: (picture)C. When histones are deacetylated, nucleosomes t

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
Explain using leucine zipper motifs as an example, how protein-protein interactions between transcription factors containing such motifs can generate diversity in transcriptional activation. Refer to the recognition of DNA elements in gene promoters to justify your answer. Assume transcription factor A binds to DNA element A’, transcription factor B binds to DNA element B’, and so forth.
Histone deacetylase (HDAC) enzymes a.Promote initiation of translation. b.Complex with hyperphosphorylated pRb. c.Repress E2F family activity. d.Add acetyl groups to E2F promoters. e.Promote initiation of transcription.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Which of these is NOT true of nucleosomes? A. Some post-translational modifications to histone proteins serve as binding sites for transcription factors. B. The position of nucleosomes is fixed on the genome and can not be changed. C. The position and post-translational modifications of histones can be inherited through mitosis. D. The binding between DNA and histone proteins can be disrupted by post-translational modifications.
From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene THERE are multiple answer for this that I can choose Group of answer choices A 3' UTR B PPE sequences C 5' UTR D introns E core promoter F coding sequence G DNA-bending protein H enhancer sequence I mediator protein
Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes (including many cancer-causing genes). Scientists determine that the histones from the cancer cells have an overall/average lower affinity for DNA than histones from normal control cells. Which drug is most likely to help treat this patient's cancer? a. An inhibitor for HMT (histone methyltransferases) b. An inhibitor for HDM (histone demethylases) c. An inhibitor for HDACs (histone deacetylases) d. An inhibitor for HATs (histone acetyltransferase)
A mechanism of control in E. coli not discussed in this chapter involves pausing of ribosomes allowing a transcription terminator to form in the mRNA. In eukaryotic fission yeast, this mechanism should a. be common since they are unicellular. b. not be common since they are unicellular. c. not occur as transcription occurs in the nucleus and translation in the cytoplasm. d. not occur due to possibility of alternative splicing.
You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter regions, where the RNA polymerase II and transcription factors would bind THERE ARE MULTIPLE ANSWERS THAT YOU CAN CHOOSE From the list given - choose all components that you think are part of a typical eukaryotic gene Group of answer choices A core promoter B 3'UTR C introns D enhancer E coding sequence F mediator protein G PPE H exons I DNA-bending protein J 5'UTR
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
In a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).