Please answer fast 19. You have reasonably short, typical, double stranded DNAsequence. Basically how many proteins can it potentiallyencode?a. 2b. 3c. 6d. 120. Which of the following sentence best describes thedifference between a global alignment and local alignmentbetween 2 sequences?a. Global alignmnent finds global maximum, while localalignment fins local maximumb. Global alignmnets usually used for DNA sequences,while local alignment is used for protein sequencesc. Global alignment aligns the whole sequence, whilelocal alignment finds the best subsequence that alignsd. Global alignments has gaps, while local alignment hasno gaps21. The extent to which two nucleotide or protein sequencesare related defined as:a. Similarity (quizlet)b. Homologyc. Identityd. Conservation

DNA's molecular structure is referred described as a "double helix." Two connected strands that…

Answered: 19. You have reasonably short, typical,…

19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins can it potentially encode? a. 2 b. 3 c. 6 d. 1

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Related questions

Q: 5. The products of glycolysis include A pyruvate . B. ATP C. NADH D A and B . E. A, B and C

A: The Glycolysis is a ten step enzymatic reaction where a six carbon containing sugar molecule is…

Q: Choose one of the specific biotechnology examples in this Activity. Using details from this Activity…

A: The scientific area of biotechnology deals with the use of biological methods for improving human…

Q: Using forked line method, figure out the phenotype and genotype of the offspring between two…

A: Given, Parental genotype AaBbCC AabbCc

Q: To define the qualities of an effective vaccine.

A: Introduction Vaccines are the biological products which protect our body from different diseases.…

Q: Q3.9. For which of the following is potential energy DECREASING? (Hint: Click here to see an…

A: INTRODUCTION Potential energy is stored in living cells in the form of ATP.

Q: what is biology

A: Introduction: Any system of knowledge concerned with the physical world and its phenomena that…

Q: does the concept of genetic transfer and mapping in bacteria significant to understanding bacterial…

A: Bacterial genome It constitutes a single, circular chromosome. The genome of bacteria is usually…

Q: 5c. If not, what additional information would we need to collect to tell whether the yeast used…

Q: glycolysis.

A: The metabolic pathway is defined as the set of interactions that occur between the genes and their…

Q: Which is true for Non-Shivering Thermogenesis? Group of answer choices It is associated with…

A: A Muscle Contraction Is Triggered When a Potential Travels Along the Nerves to the Muscles. Muscle…

Q: Explain the central dogma of inheritance. Cite a specific example

A: Introduction: The hereditary substance in humans and almost all other animals is DNA, or…

Q: Which part of the cytoskeleton attach to integrins?

A: Introduction :- Animal cells primarily bind to the extracellular matrix using integrins as their…

Q: Substances that are injected containing an antigen to stimulate the immune system to respond are…

A: The immune system is a control network of organs and immune cells that detect and kill foreign…

Q: We use salting and freezing to preserve our food against bacteria. Explain why is food preserved…

A: Salting: Common salt (NaCl) used to preserve food by making it unavailable for microorganisms.…

Q: Explain the process of bacterial DNA extraction.

A: DNA extraction DNA extraction is a method of separation and isolation of pure DNA from other…

Q: steroids two covalent the number of double bonds chemical groups 2 male female effects proteins…

A: In many cases observe in nature, the basis of the morphological differences observed between the…

Q: 17- Nutrient molecules are transported from PCT and DCT to per tubular capillaries by Filtration,…

A: The production of urine, liquid excretion through kidney involves three main parts of nephron- the…

Q: QUESTION 9 What is the relationship between action potential conduction velocity and axonal…

A: Introduction :- The nervous system's ability to transmit information is constrained by the rate of…

Q: Compare and contrast the immune reaction for: -pathogen, allergy, and autoimmunity. Talk about the…

A: Immunity is the complex cellular and molecular mechanism of the body to maintain healthy conditions…

Q: draw and explain a diagram of the life cycle of atypical mushroom

A: Introduction The fleshy, spore-bearing fruiting body of a fungus that normally grows above ground,…

Q: Which of the following nutrients are absorbed in the stomach? a Carbohydrates, lipids, and…

A: The gastrointestinal tract, as well as the digestive organs that support it, make up the human…

Q: Identify the limitations of the HACCP system.

A: Hazard Analysis Critical Control Point (HACCP) is a systematic set of rules for food safety…

Q: Describe the way in which bone marrow transplantation can lead to therapeutic effects.

A: Bones are state defined that they are provide support and protection to the body and its organs.…

Q: choose a product of nanotechnology and Discuss the purpose and how the technology is used. It is…

A: Introduction Nanotechnology or nanotech is a branch of science which deals with matters like…

Q: how are specific molecules used to change a gene expression

Q: True or False: p + q = 1 is the difference of individuals alleles within a given population that is…

A: The Hardy Weinberg Equation is used for calculating the frequency of the various alleles and…

Q: Which statement is TRUE regarding the glycolytic pathway? It includes five phosphate transfer…

A: Introduction The metabolic process that turns glucose into pyruvic acid is known as glycolysis. The…

Q: A dormant virus can be activated and enter the Lytic cycle True False Viruses produce toxins in…

A: Those viruese which have another phase of replication called as latent phase and these viruses…

Q: 2. Describe each of the trends in primate evolution and why it's beneficial: Description Benefit…

A: Description Benefits Prehensile hands and feet/ opposable thumbs Prehensile tail used as a…

Q: A certain species of rabbit can have either black or grey fur. The allele for black fur is dominant…

A: Introduction: A phenotypic ratio is a tally of the amount of children with one phenotype vs another.…

Q: Student X is always not feeling well. She's experiencing the following symptoms: Sweating,…

A: Note: since you have posted multiple questions, so we will be solving the first one for you. As per…

Q: Which of the following describes stabilizing selection?! Migration of individuals to an area with…

A: When selective pressures select against the two extremes of a trait, the population experiences…

Q: Q3.6. Some students have the misconception that during cellular respiration, the matter in glucose…

A: The correct option is (a)our cells use up the potential energy stored in glucose ,and losing that…

Q: Measles is an example of a disease caused by a bacterium. True False A dormant virus can be…

A: The viruses are microbes which proliferate only inside the host. These can not grow and reproduce…

Q: Query Sequence A 0 Database Sequence B 10 0 5 Match 1 30 35 38 25 40 30 33 Match 2 Mismatch Match 50

A: Sequence alignment refers to the arrangement of the DNA/RNA/protein sequences to find out the…

Q: Based on their function several types of complex media can be described. Discuss this statement by…

A: Complex media This media is referred to as the media having nutrients that constitute water-soluble…

Q: Which type of population dispersion is characterized by a high population density? a uniform…

A: Dispersion is the pattern of spacing of population. It is of following types - Clumped Random…

Q: To explain the mechansim of histocompatibility.

A: Innate defence and adaptive defence are two bodily processes that guard against pathogens. Innate…

Q: An example of organizational hierarchy in biology at the atomic level is _____. a oxygen b…

A: Levels of organization are structures in nature, usually defined by part-whole relationships, with…

Q: in a populations of 200 flies: 45 Hamozygous Purple, Solleterozygous Purple, 105 Homozyous grien use…

A: Given information Total number of flies = 200 Homozygous purple flies having the genotype PP are 45…

Q: 1. Which sugar is a monosaccharide? a. Maltose b. Glucose c. Sucrose d. Lactose

A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…

Q: Which of the following would lead to a DECREASE in atmospheric methane concentration?

A: Methane. Methane is a chemical compound and alkane has the formula CH4. It serves as the major…

Q: Please explain prokaryotic translation.

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: A microbiology professor noted that in the fall when the apples are ripe, her cow, appropriately…

A: Introduction : The pyruvic acid produced during glycolysis is exposed to oxidative decarboxylation…

Q: Indentify the four major categories of hypersensitivity or overreactions to antigen.

A: Immunopathology is the condition of disease brought on by immune system failure. Life-threatening…

Q: Intravenous solutions must be prepared, to that they are isotonic to red blood cells. A 0.9% salt…

A: Introduction Isotonic solutions are those that have the same concentration of water and solutes as…

Q: Most of the bacteria are harmful. O True O False All prokaryotes are placed in one of the six…

A: Bacteria are the ubiquitous single-celled microbes that fall under the kingdom Monera. Bacteria are…

Q: Given DNA strand: 5' T G T T A G T C G A A T 3' Write its complementary DNA and its mRNA.

A: The DNA or deoxyribonucleic acid is the double standard helical macromolecule. It is the genetic…

Q: Which of these variables is NOT ethically practiced when producing transgenic animals…

A: Genetically altered animals or transgenic animals are animals with a modified genome due to the…

Q: Your mother has Huntington's disease, an autosomal dominant disorder. Your father is not diseased.…

A: Huntington chorea is a autosomal dominant disorder , so the person will be affected if even a single…

Question

Please answer fast

19. You have reasonably short, typical, double stranded DNA
sequence. Basically how many proteins can it potentially
encode?
a. 2
b. 3
c. 6
d. 1
20. Which of the following sentence best describes the
difference between a global alignment and local alignment
between 2 sequences?
a. Global alignmnent finds global maximum, while local
alignment fins local maximum
b. Global alignmnets usually used for DNA sequences,
while local alignment is used for protein sequences
c. Global alignment aligns the whole sequence, while
local alignment finds the best subsequence that aligns
d. Global alignments has gaps, while local alignment has
no gaps
21. The extent to which two nucleotide or protein sequences
are related defined as:
a. Similarity (quizlet)
b. Homology
c. Identity
d. Conservation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

With regard to dideoxy sequencing, which of the following statementsis false?a. The dideoxy nucleotides are fluorescently labeled.b. The dideoxy nucleotides cannot be incorporated into a growingDNA strand.c. When incorporated into a DNA strand, the dideoxynucleotidesprevent further growth of the strand.d. The dideoxy sequencing method is used to determine the basesequence of DNA.e. The dideoxy sequencing method requires the use of primers.
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
1. a. Draw the primers for this longer strand (consider optimal length): TTGCTTAAATTTAAATTTATGCCGTAAGCGCGCGC b. Explain which PCR step is most dependent on the genetic code for proper temperature programming and why.
2b) If you denatured the random 1000 bp fragments of potoroo DNA by heating them to 95°C. and then cooled them down to 60°C and allowed them to reanneal, you would find that approximately 20% of the DNA fragments renatured very rapidly, another 30% of the DNAfragments renatured moderately rapidly, and the remaining DNA fragments renatured relatively slowly. From these results, whatfraction of the potoroo genome is composed of highly repetitiveDNA? helpful Information
18A. How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect nt is incorporated how many equivalents of ATP are required to fix this?
The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the gel?
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
VII. Rosalind Franklin (Early 1950s) A. What did she discover about the probable shape of DNA? B. What controversy surrounds Rosalind Franklin?
Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference