M S R E P

Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in ...

A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the mutan...

Q: How can adults continue to function relatively normally after surgery to remove the thymus, tonsils,...

A: Introduction  Fluids tissues are generally the part of connective tissue which helps in the transpor...

Q: All of the following are involved in DNA replication excepta) polysome.    b) gyrase.        c) poly...

A: DNA is the genetic and hereditary material in all living organisms. When a cell divides, DNA is dist...

Q: Evaluate the relative resistance of diff erent groups of infectious agents.

A: Answer of the question given below...

Q: Use the following information to answer questions 1 and 2. I. a 70-kg swimmer swimming 3 m/s II. a 0...

A: 1)   The item with the least momentum is        D)  IV  ( a 0.010 kg bullet travelling 600 m/s )   ...

Q: Which gene has abnormality when a person have depression ?

A: In science, a gene is an essential unit of heredity and a succession of nucleotides in DNA that enco...

Q: Assemble the gram negative bacteria cell wall

A:   In Gram-negative bacteria, the cell wall is made up of polymer peptidoglycan, a compound chain of ...

Q: What is the role of genetics in bipolar depression ?

A: Introduction  Bipolar disorder is a mental disorder that can affect severely. The symptoms are unpre...

Q: Regarding EV71 infection, the following statement about this pathogen is correct, EXCEPT The best pr...

A: Enterovirus 71 (EV71) infection is a neurological disease that is caused by enterovirus 71. It is a ...

Q: Genot Genot уре уре Gene Genotype Frequencies Gene Frequ Frequ encies encies Frequencies Frequenci G...

A: A population is said to be in Hardy Weinberg Equilibrium (HWE) if there is no change in the allele f...

Q: In a heterozygous state, being dominant implies that the dominant allele: has a chemical relationshi...

A: Given: In a heterozygous state, being dominant implies. 

Q: How does the linkage of traits impact selection decisions in a breeding plan?   B. How are molecul...

A: The geness which are present on the same chromosome and at present closer to each other can we inher...

Q: the template DNA coding for the polymorj

A: Introduction   Peptides and Proteins Assuming the amine and carboxylic corrosive utilitarian gatheri...

Q: What the best from these ( Bacteria, archaea and fungi ) for bioremediation and Why?

A: Bioremediation is the process of using bacteria, fungus, and plants to degrade, remove, modify, immo...

Q: What conditions in an environment can affect enzyme activity?

A: Introduction :- enzyme is a molecule that works as a catalyst in living organisms, controlling the p...

Q: Choose the combination of answers that most accurately completes the statement.R factors are _______...

A: A small, extra chromosomal DNA molecule within a cell is known as plasmid . It can be physically sep...

Q: Explain the germ-free condition and how it is important to microbiologists.

A: Introduction: Germ-free condition refers to a complete absence of living microorganisms. Many animal...

Q: Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Aden...

A: The nucleic acids (DNA and RNA) are made up of nucleotides. The nucleotides are composed of phosphat...

Q: what does DNA tests tell us about the time frame or circumstances under which DNA came to be associa...

A: DNA fingerprinting is an important tool of molecular Biology. It is an ideal way to distinguish the ...

Q: Differentiate between good and bad cholesterol?

A: Introduction: Plasma is a transparent, straw-colored fluid component of the blood that accounts for ...

Q: Choose the combination of answers that most accurately completes the statement.Which of the followin...

A: Antimicrobial drugs are drugs that either kill a microbe or inhibit the growth of a microbe. There a...

Q: Post-Assessment dilil amiw susdo bin omi Complete the concept map on the central dogma of molecular ...

A: The expression of genetic material occurs generally through the production of proteins this involved...

Q: Scenario 1. Microbial examination of Food (Aerobic Plate Count) Fifty grams of food sample (vegetabl...

A: The method used in this experiment is the spread plate technique, where 0.1 ml of the culture sample...

Q: List two reasons why using a cell phone while driving is dangerous.

A: The use of cell phone while driving is dangerous because the most cautious drivers can be distracted...

Q: Explain what is meant by the terms microbiota and microbiome and summarize their importance to human...

A: Microbes are organisms that are too small to detect without a microscope, such as bacteria, archaea,...

Q: Trisomy 18 (Edwards Syndrome) is identified by a karyotype that shows A. too few copies of chromoso...

A: The normal number of chromosomes present in homo sapiens, I.e Human Beings is 46( 44 autosomes (22 p...

Q: Which of the following statement is true for Orthomyxoviruses but NOT Paramyxoviruses: Viral genome...

A: Orthomyxoviruses Contains 8 segments of single stranded negative RNA It has nucleocapsid, that cont...

Q: For which one of the following enteric illnesses is a chronic carrier state most likely to develop? ...

A: Chronic carrier state refers to acts as the carrier or reservoir of the pathogen and the carrier has...

Q: Use diagrams to explain how the level of ATP in living cells can remain almost constant while ATP is...

A: Adenosine tri-phosphate (ATP) is the energy carrying molecule in cells of living organisms.It does n...

Q: "pward 10. 11-15. You have probably heard the saying "no man is an island," This saying means that e...

A: Although each organ has its specific functions, organs also function together in groups, called orga...

Q: What are the two main variants of the skin pigment molecule in humans? How do the differ?

A: Given: The two main variants of the skin pigment molecule in humans. 

Q: Choose the combination of answers that most accurately completes the statement.The MIC is the ______...

A: Minimum inhibitory concentration test is a quantitative method used to determine which class of anti...

Q: 1. Which of the follovwing is NOT considered CPE caused by virus infection? A. Cytolysis B. Electron...

A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...

Q: Discuss the sustainable land management techniques that are employed in Lesotho regarding soil and w...

A: Sustainable land management (SLM) used for the protection, conservation and the restoration of natur...

Q: Explain why desiccation and cold are not reliable methods of disinfection but how they can still be ...

A: Physical and chemical agents are used to keep microbial growth under control. Temperature control, d...

Q: Fill in the blank: The cellular membrane is considered material to pass through, but keeps other out...

A: Introduction :- The fluid mosaic model :- Various findings on the structure of functional cell membr...

Q: 3. Passive & Active Transport Passive Transport Active Transport Does it use energy? What is the con...

A: 3.Active and Passive transport are the two ways through which the molecules can be moved across a me...

Q: A. Write the structure of the pentapeptide GLDSC.

A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...

Q: a. sensory neurons b. cell body c. Schwann cell d. axon e. motor neurons f. sodium g. processing neu...

A: 81) sensory neurons are responsible for detecting stimulus 82) processing/inter neurons are responsi...

Q: What is the main function of a phospholipid bilayer?

A: All the cells are covered by a cell membrane.  

Q: A man has a severe case of sinusitis that is negative for bacterial pathogens. A physician prescribe...

A: Sinuses are paired air filled, hollow cavities in the skull. The cavities are located behind the for...

Q: scientist working for a pharmaceutical company, you are asked to enginner bacteria that will produce...

A:  Human growth hormone is a protein hormone which is produced by anterior pituitary gland. Growth hor...

Q: 10. To have an accurate data on the weight of the fish, which of these will you do? a. Weigh the fis...

A: Fish is one of the most inseparable component of human diet. It is a source of high protein and pota...

Q: Describe the consequences of removing or adding nucleotides.

A: Changes in nucleotide bases produce mutations, which are errors in codons. It's possible that certai...

Q: What are Lipids? Give an example?

A: Cells are the basic units of life, all organisms are made of cells. Cells are in turn made of variou...

Q: ence - Ed x r02.core.learn.edgenuity.com/Player/ Classes ife Science English Identifying Levels of O...

A: Levels of organization are different levels of organization of cells which make a complex tissues. D...

Q: UNSCRAMBLE THE WORDS   TOPIC: EVOLUTION, NATURAL SELECTION, HISTORY OF LIFE ON EARTH  1. ( M C A ...

A:   1. Caladogram 2. Embryology 3. Paleontology 4. Population 5. Pontificate    

Q: Describe the development of drug resistance, and explain how it is acquired.

A: Drug resistance refers to a medication's reduced effectiveness in treating a disease or condition, s...

Q: When would the lac operon in E. coli be repressed, and why?

A: Operon includes a group of structural genes and regulatory sequences.  

Q: Think of three situations in which the same microbe would be considered a serious contaminant in one...

A: Microorganisms are microscopic organisms that can be viewed only through microscopes. There are seve...

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.