Match the part of a cell from the left column to the best description on the right. Golgi Apparatus A. all eukaryotic cells have one of these Chloroplast Rough Endoplasmic Reticulum (ER) Mitochondria Nucleus Plasma Membrane Cytoskeleton Cell Wall B. site of photosynthesis C. gives cells shape and involved in cell movement D. site of cellular respiration E. made of phospholipids and surrounds cell F. synthesizes new proteins I G. outside of plasma membrane H. involved in exocytosis
Q: Which of the following represents the correct order of the phases of the cell cycle
A: Introduction: The cell cycle is the sequence of events that a cell goes through as it grows and…
Q: draw a punnett square, one parents is domincat tall, one is mixed hybrid, name 4 possible offspring.
A: Introduction: The scientific study of heredity and variation in living things is known as genetics.…
Q: For each question, choose the cell drawing(s) from those labeled A to P that best meets the listed…
A: During prophase, the mitotic spindle also starts to form. Microtubules gradually build up between…
Q: Explain possible explanations for the differences noted among the diffusion rates of the three…
A: Among the few factors that affect the diffusion rate, molecular weight is the major one. As is…
Q: What are opsin genes and on which chromosome are they located in humans?
A: Introduction: A gene is a segment of DNA that provides the instructions to make a specific protein.…
Q: 3. What is a correct implication of Chargaff's analysis of base compositions of DNA? Base pairing is…
A: Introduction : Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the…
Q: functional injury to endothelial cells would most likely result in which of the following?…
A: Endothelial cells are cells that line the inner surface of blood vessels and form the central…
Q: The nuclear export cycle is shown in the diagram. nuclear export receptor [Select] cargo. [Select]…
A: According to Bartleby guidelines only the 1st question can be answered. Please repost the remaining…
Q: How does Mendel’s postulates relate to human beings?
A: Gregor Mendel's postulates have revolutionized the way we look at genetics and human biology. His…
Q: In the United States, approximately one in three babies is delivered via cesarean (c-section).…
A: A caesarean delivery is characterized as the delivery of a foetus through incisions made in the…
Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…
A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…
Q: Oxygen-binding proteins myoglobin and hemoglobin require the prosthetic group ______.
A: Myoglobin and hemoglobin are protein molecules found in muscles and blood respectively. Myoglobin…
Q: Required information View the animation below, then complete the quiz to test your knowledge of the…
A: Introduction Simple diffusion is a process that occurs without the use of energy or specialized…
Q: Explain what would occur during fetal development to an XY individual with a mutation causing a…
A: Introduction: Disorders of sex development (DSD) refer to a group of conditions that affect the…
Q: Clinical trials can be designed to demonstrate that a new technology offers measurable, relevant…
A: Clinical trial or often termed "medical trials" are research designs aimed to evaluate the…
Q: Why and how do you think the phenomenon of periodicity in filiarial worms evolved?
A: Microfilaria is the early Juvenile stage in many of the worms belonging to the group nematodes.…
Q: Provide the smallest molecular unit of most lipids, proteins, and nucleic acids.
A: Introduction : The essential organic substances needed for the maintenance and development of…
Q: why do transmembrane proteins cross the phospholipid bilayer as an a-helix or B-barrel? A. These…
A: Transmembrane proteins are the proteins that span across the plasma membrane of the cell. Their…
Q: 18. Substrate-level phosphorylation is of physiological importance: in all cells to a small extent…
A: Substrate-level phosphorylation is a form of metabolic pathway that plays an important role in…
Q: Complete each statement by dragging each label into the appropriate blank. gain 2.0 hypotonic expand…
A: Introduction Tonicity is a term used in biology to describe the relative concentration of solute…
Q: What are mitosis and meiosis? These two processes are how parent cells produce daughter cells.…
A: Cell division is the process by which cell divides to produce daughter cells. There are two types of…
Q: Below is the pedigree of one form of hemophilia. Which type of hemophilia can you rule out? (You…
A: Hemophilia is a disease where blood doesn't clot normally . And due to this excessive bleeding…
Q: Characterize host traits that can impact susceptibility to disease. Provide 5 examples.
A: The susceptibility of an individual to a particular disease is determined by a variety of factors,…
Q: The goal of this assignment is to introduce you to methods used to determine reliable sources of…
A: A nutritious diet supports normal growth, development, and ageing, helps people maintain a healthy…
Q: QUESTION 13 The following is the site where a lipid is added to a protein to make a lipoprotein: O…
A: A lipoprotein is a biochemical assemblage whose main job is to move fat molecules in water that are…
Q: The function of FG-nucleoporins within the nuclear pore complex is to: shield large, hydrophilic,…
A: Nuclear transport is the term used to describe the movement of molecules across the nuclear…
Q: 1) Which sequence represents the correct order of events for the production of necessary complex…
A: The group of chemical processes in organisms that maintain life is known as metabolism. The three…
Q: The main sweetener in Mackies Honeycomb is _______________
A: A sweetener adds sweetness in the product in which it is added. It may be of two types natural…
Q: beavers build dom in a stream
A: Beavers These are large, semiaquatic rodents found in the Northern Hemisphere. These are the second…
Q: Can you explain in technical detail how alternative sigma factors and quorum sensing work and what…
A: Living beings regulate gene expression at many levels. The responses to the environment are…
Q: Milk is a solution, containing the dissolved solutes protein and sugar (the fat does not dissolve…
A: Milk constitutes more water about 87% than any other element. The major contents are water, fat,…
Q: Which can NOT be found in vessels? O a. Tyloses O b. Pits O c. O d. Resin Perforation plates
A: A vessel is a plant structure that distributes fluids such as water, sap, and nutrients from the…
Q: Can you match these prefixes, suffixes, and word roots with their definitions? micro- -phyll hyper-…
A: There are different words in biology,which are used to describe particular process,or…
Q: Is the whole protein (destined for the ER) synthesized and then moved to the ER or is it synthesized…
A: Introduction:- Protein molecules are the polymers of amino acids. Amino acids are linked with each…
Q: Malignant hyperthermia More than one answer mayy be correct. Question 8 options: can by…
A: Malignant hyperthermia is a genetic disorder which follows autosomal dominant inheritance pattern.…
Q: Why is the skin cancer rate in Australia so high? Claim 2: There is something different about…
A: Skin cancer is a common type of cancer that affects a large number of people in many countries. Skin…
Q: Label the dna
A: Introduction: DNA (Deoxyribonucleic Acid) is a long polymer that stores and transmits genetic…
Q: Phylum Porifera: • Construct a Table with five rows and four columns. Column 1 will be labeled…
A: Porifera is a phylum of aquatic animals that include sponges. They are known for their porous and…
Q: chromosome number of 6. Indicate maternally- & paternally-derived chromosomes as red and blue,…
A: Introduction of Meiosis - is the process by which "gametes" (sex cells), with half the number of…
Q: Unlike mammalian red blood cells, the red blood cells of amphibians contain large nuclei. Speculate…
A: INTRODUCTION Animals that can live both on land and in water are known as amphibians. They have a…
Q: Which one of the following is NOT a characteristic of prokaryotic cells? Cytoplasm.…
A: INTRODUCTION The oldest single-celled microbes on Earth are prokaryotic cells. Bacteria and archaea…
Q: For each of the samples below, calculate the mean, variance, standard deviation, and standard error…
A: Answer : For females :
Q: at ed $ 7) a 8) Describe one example of diffusion in the human body. In your description be sure to:…
A: Insulin/Glucagon Diffusion- • We have modeled the rate of insulin and glucagon secretion at the…
Q: 1) Which sequence represents the correct order of events for the production of necessary complex…
A: Introduction : The interaction of organ systems is essential for the proper functioning of the…
Q: Craig Venter's group reported sixfold coverage of the H. influenzae Rd genome. Given that the genome…
A: Craig Venter's group was able to sequence the human pathogen Haemophilus influenzae Rd genome with…
Q: Define primary (essential) hypertension. Identify and briefly explain three modifiable risk factors…
A: Comprehensive physical, mental, and social well-being is a condition of being in good health. It…
Q: What is the function of a promoter in gene expression?
A: Transcription is the process through which ribonucleic acid (RNA) is synthesised from DNA. The term…
Q: Radial symmetry is most common among sedentary organisms or organisms that drift passively with…
A: The body parts of an organism are arranged around a central axis like the spokes of a wheel in a…
Q: How would you educate a client (at risk of developing high cholesterol) about "good" and "bad"…
A: The body contains two different forms of cholesterol, known as good cholesterol and bad cholesterol.…
Q: How are the blood drops at different heights alike?
A: Answer: One of the body's connective tissues is blood, which is made up of cells and cell fragments…
Introduction
Cell organelles are tiny structures within a cell that have specific functions to help the cell carry out its daily activities. They are like little organs within the cell, each with its own unique job to perform.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Enzymes. contalned in _______ break down worn-out organelles, bacteria, and other particles. a. lysosomes b. amyloplasts c. endoplasmic reticulum d. peroxisomesAntibiotic Effects on Mitochondria Tetracyclines are antibiotics that inactivate bacterial ribosomes. Knowing that mitochondria evolved from bacteria, researchers suspected tetracyclines might affect mitochondria by harming their ribosomes. FIGURE 19. 11 shows the effects of an experiment in which mice were given either tetracycline or a control antibiotic that affects cell wall production. After 10 days of treatment, the function of mitochondria in the mice was assessed. FIGURE 19.11 Effects of tetracycline on mitochondria. Mice received low-dose tetracycline, high-dose tetracycline, or a control antibiotic that targets bacterial cell walls. Mitochondrial function was assessed by looking at oxygen consumption rate and ATP content in homogenized mouse livers. Bar graphs show means with standard error. An indicates a statistically significant difference between the experimental and the control treatments. How did the two drugs differ in their effect on oxygen consumption by mitochondria?25. this part of the cell is described as a heterogeneous, colored plastid responsible for pigment synthesis in eukaryotic organisms.a. chloroplastsb. ribosomesc. golgi apparatusd. chromoplast
- THANK YOU PO NG MARAMI 11. which of the following describes a protoplasm? I. Membrane-bound structure II. Fluid content of the cell III. Synonymous to the term cytosola. l,llb. ll,lllc. l,ll,llld. l,lll 12. What is the initial component of the protoplasm? a. mitochondriab. cytoplasmc. plastidsd. nucleus13. In reference to answer on number 12 what is its function?a. connects two plant cellsb. maintains the shape of the cellc, suspend the organellesd. produce proteins for the cell14. Which of the following describes the metabolism property of protoplasm?a. stores substances for the organellesb. processes genetic informationc. modifies proteins and lipidsd. utilizes degradative chemical reactions that break down complex molecules15. which of the following describes the metabolism property of protoplasm?a. glycosidesb. calcium oxalatec. alkaloidsd. cystolithsTHSNK YOU PO IN ADVANCE 21. these are the described as organic catalysts of the protoplasm a. tannisb. alkaloidsc. proteinsd. enzymes22. these are bitter substances found in the barks of woody plantsa. proteinsb. tannisc. mucilages23. what part of the cell regulates the entry and exit of specific substances within the cella. cell membraneb. ribosomec. cystosold. mitochondria24. it consists of cellulose and glycoproteins that protect and provide structural support to the cella. cell membraneb. cell wallc. plastidd. nucleoplasm25. this part of the cell is described as a heterogeneous, colored plastid responsible for pigment synthesis in eukaryotic organisms.a. chloroplastsb. ribosomesc. golgi apparatusd. chromoplastWhat would happen to a cell if the mitochondria cristae were damaged? should be an original thought, not Google’s few snetences dont use others answers
- Infoldings of the plasma membrane into the cytoplasm of some ancestral cells may have evolved into the _______. a. nuclear envelope b. ER membranes c. primary cell wall d. both a and bAntibiotic Effects on Mitochondria Tetracyclines are antibiotics that inactivate bacterial ribosomes. Knowing that mitochondria evolved from bacteria, researchers suspected tetracyclines might affect mitochondria by harming their ribosomes. FIGURE 19. 11 shows the effects of an experiment in which mice were given either tetracycline or a control antibiotic that affects cell wall production. After 10 days of treatment, the function of mitochondria in the mice was assessed. FIGURE 19.11 Effects of tetracycline on mitochondria. Mice received low-dose tetracycline, high-dose tetracycline, or a control antibiotic that targets bacterial cell walls. Mitochondrial function was assessed by looking at oxygen consumption rate and ATP content in homogenized mouse livers. Bar graphs show means with standard error. An indicates a statistically significant difference between the experimental and the control treatments. Do these results support the hypothesis that tetracyclines impair mitochondrial function?Antibiotic Effects on Mitochondria Tetracyclines are antibiotics that inactivate bacterial ribosomes. Knowing that mitochondria evolved from bacteria, researchers suspected tetracyclines might affect mitochondria by harming their ribosomes. FIGURE 19. 11 shows the effects of an experiment in which mice were given either tetracycline or a control antibiotic that affects cell wall production. After 10 days of treatment, the function of mitochondria in the mice was assessed. FIGURE 19.11 Effects of tetracycline on mitochondria. Mice received low-dose tetracycline, high-dose tetracycline, or a control antibiotic that targets bacterial cell walls. Mitochondrial function was assessed by looking at oxygen consumption rate and ATP content in homogenized mouse livers. Bar graphs show means with standard error. An indicates a statistically significant difference between the experimental and the control treatments. Why was a control antibiotic used, rather than using untreated mice as the control?
- Antibiotic Effects on Mitochondria Tetracyclines are antibiotics that inactivate bacterial ribosomes. Knowing that mitochondria evolved from bacteria, researchers suspected tetracyclines might affect mitochondria by harming their ribosomes. FIGURE 19.11 shows the effects of an experiment in which mice were given either tetracycline or a control antibiotic that affects cell wall production. After 10 days of treatment, the function of mitochondria in the mice was assessed. FIGURE 19.11 Effects of tetracycline on mitochondria. Mice received low-dose tetracycline, high-dose tetracycline, or a control antibiotic that targets bacterial cell walls. Mitochondrial function was assessed by looking at oxygen consumption rate and ATP content in homogenized mouse livers. Bar graphs show means with standard error. An indicates a statistically significant difference between the experimental and the control treatments. Which rats had the least ATP in their livers?Enzymes. contalned in _______ break down worn-out organelles, bacteria, and other particles. a. lysosomes b. amyloplasts c. endoplasmic reticulum d. peroxisomesMitochondrial Abnormalities in Tetralogy of Fallot Tetralogy of Fallot (TF) is a genetic disorder in which heart malformations result in abnormal blood circulation, so oxygen does not reach body cells as it should. With insufficient oxygen to accept electrons at the end of miotchondrial electron transfer chains, too many free radicals form. This damages the mitochondriaand the cells. In 2004, Sarah Kuruvilla studied mitochondria in the heart muscle of TF patients. Some of her results are shown in FIGURE 7.13. Patient (age) SPO2(%) Mitochondrial Abnormalities in TF Number Shape Size Broken 1(5) 55 + + 2(3) 69 + + 3(22) 72 + + 4(2) 74 + + 5(3) 76 + + + 6(2.5) 78 + + + 7(1) 79 + + 8(12) 80 + + 9(4) 80 + + 10(B) 83 + + 11(20) 85 + + 12(2.5) 89 + + FIGURE 7.13 Mitochondrial changes in tetralogy of Fallot (TF). (A) Normal heart muscle. Many mitochondria between the fibers provide muscle cells with ATP for contraction. (B) Heart muscle from a person with TF has swollen, broken mitochondria. (C) Types of mitochondrial abnormalities in TF patients. SPO2 is oxygen saturation of the blood. A normal value of SPO2 is 96%. Abnormalities are marked +. 3. Can you make any correlations between blood oxygen content and mitochondrial abnormalities in these patients?