Unlike mammalian red blood cells, the red blood cells of amphibians contain large nuclei. Speculate about the consequences on the relative oxygen-carrying capacity of amphibian red blood cells and the effects this could have on the potential metabolic rates of both animal groups. CHAPTER 2 Animal Cells and Tissues 35

Q: 3) if a normal sighted male has children with a carrier woman a) what proportion of their daughters…

A: Q.Ans:- Explanation:- Color blind move to an offspring in an X-linked recessive manner. Let 'A'…

Q: What is the structue of dopamin, and suggest the binding interactions of dopamine with the receptor.…

A: The substantia nigra and the hypothalamus are two regions of the brain that release the chemical…

Q: Pituitary gland tumors can secrete excess amount of growth hormone. Describe the signs and symptoms…

A: Pituitary gland has two components anterior and posterior pituitary.  Growth hormone is produced by…

Q: 1) Thalassaemia is a form of anaemia common in Mediterranean populations and resulting from a…

A: The body doesn't make enough protein called hemoglobin, due to an inherited disorder called…

Q: Explain DNA methylation.

A: Introduction : Changes in gene activity or function that are passed down from generation to…

Q: GIARDIA LAMBILA , Ascaris lumbricoides are common parasites found in Guyana and discuss the…

A: Introduction  There are many life forms that are pathogenic to humans. Some live as a parasite…

Q: Importance of Understanding the Scientific Method 5. Why are the following critical to the validity…

A: Scientific methods are ideal ways of performing an experiment. The observations formulated in the…

Q: 1) Plumage colour in mallard ducks is controlled by a number of alleles at one locus. MR is the…

A: The gene is the sequence of nucleotide bases in DNA, which code for a specific protein or functional…

Q: Discussion on cell division in onion root tip cell

A: The type of cell division studied in onion root tip cell is mitotic cell division. There are 8 sets…

Q: PART A. Redraw the table below on the whiteboard. Use your biological molecules handout to fill in…

A: Shapes, sizes, charges, and reactivities of the R groups 9f amino acids vary.  As a result, amino…

Q: Human immunodeficiency virus entered human populations after evolving from a simian immunodeficiency…

A: Human immunodeficiency virus (HIV) is a virus that attacks the immune system, specifically targeting…

Q: Hookworm and Ascaris lumbricoides is a common parasites found in Guyana and discuss the prevalence,…

A: Introduction Hookworm and Ascaris lumbricoides belong to the phylum Achehelminthes…

Q: Calculate the number of ATP formed from NADH and FADH2. The calculation should be based on the total…

A: NADH and FADH2 are both coenzymes that play important roles in cellular metabolism. NADH stands for…

Q: Based on the attached image, identify the stage at which each cell is in and draw an animal cell…

A: Mitosis is a type of cell division that occurs in normal cells and is required for growth and…

Q: Need. help with c and d please, thank you!

A: The graph depicts the influence of glycosylation on the CD4 receptor on HIV infectivity in human and…

Q: Draw a picture of a squamous tissue cell: Draw a picture of a cuboidal cell: Draw a picture of a…

A: The type of cells that lines the insides and outside of various organs and components of the body is…

Q: A protein is a glycoprotein and it is active when it is glycosylated. The gene of this protein was…

A: Glycosylation is a process by which carbohydrates are added to proteins. This process typically…

Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…

Q: State is the nutrional value of the barley in terms of carbohydrates, proteins and fats? Why barley…

A: introduction: One of the oldest cereals in existence, barley was initially grown in Southwest Asia…

Q: . Compared to innate immunity, adaptive immunity (A) has a response time of minutes to hours. (B)…

A: Our immune response protects us from the different pathogens and allergens. When an antigen…

Q: plant species has flowers that can be red, pink, or white. Flower color is controlled by one gene…

A: According to Hardy Weinberg equation p2 + q2 +2pq =1 and p +q =1 Where  p= frequency of the dominant…

Q: If the body does not respond to insulin (insulin resistance), it would lead to:   a.…

A: ANSWER: The correct option is: b. hyperglycemia.

Q: Excavata Diplomonads- Two separate nuclei, no plastids, no true mitochondria, multiple flagella.…

A: Rhizaria • Cercozoa - Amoebas, flagellates, and slime molds • Foraminifera - Single-celled organisms…

Q: For each G protein below, draw an arrow to its downstream effector(s), second messenger(s), and…

A: G proteins, sometimes referred to as guanine nucleotide-binding proteins, are a family of proteins…

Q: State all the farming techniques or technologies farmers use to grow a soybean. State the soybean's…

A: Soybean (Glycine max) is an East Asian legume that is widely grown for its edible bean, which has a…

Q: One of the early results shows that the post-centrifugation pellet of encapsulated cells also…

A: Centrifugation is a technique by which molecules of different sizes and densities are separated by…

Q: 1. What does medical microbiology study? How are aniline dye solutions prepared? How to calculate…

A: Microscopy is an essential tool for biologists to observe and study the structure, function,…

Q: Crossing over between homologous chromosomes may occur O Mitosis O Meiosis Both mitosis and meiosis…

A: The procedure by which a parent cell splits into two daughters cells is known as cell division. Cell…

Q: b) Relate how the predator-prey cycle is a form of density-dependent population control.

A: ANSWER: Because of the inverse link that exists between the populations of predators and their prey,…

Q: 3. As discussed in class, single lipid layers are a great way to package materials (like drugs or…

A: Introduction:- Lipids are a type of organic compounds that are mostly insoluble in water but they…

Q: sex-specific behavior can be best described as: a) Their role is in activating neural circuits that…

A: Gonads are male and female reproductive organs. For example, the main male reproductive organ that…

Q: What type of chlorophyll used by cyanobacteria when shaded Chlorophyll a Chlorophyll b…

A: Cyanobacteria form the most important oxygen producing bacteria of the plane and are prokaryotes.…

Q: Beadle and Tatum removed arginine and other substances from the nutrient medium of the mutated…

A: Beadle and Tatum experimentally proved the "one gene one enzyme" hypothesis. They took wild-type…

Q: Compare exponential J-curve growth (line A) to logistic S-curve growth (line B). Explain the…

A: In the graph two curves are represented one is J shaped and the other one is S shaped. Both the…

Q: Tumors of the adrenal medulla, called pheochromocytomas, cause hypersecretion of catecholamines.…

A: An adrenal gland can form an uncommon, often benign (noncancerous) tumour called a pheochromocytoma.…

Q: Is the whole protein (destined for the ER) synthesized and then moved to the ER or is it synthesized…

A: Introduction:- Protein molecules are the polymers of amino acids. Amino acids are linked with each…

Q: Explain virtual water and its role in water conservation. Provide 1 example of how you can reduce…

A: Virtual water is water that is "hidden" in the products, services, and procedures that people buy…

Q: Which of these is a state-based telephone survey that attempts to ascertain the prevalence of…

A: Various surveys including state and national levels trace physical activity for the American…

Q: what are the chemical classes of hormones and give an example of each

A: Hormones are the chemical substances secreted by highly specialized cells present in our body. These…

Q: Practice: DNA Structure and Replication 1. Label each part of the model to the right. Include…

A: DNA is a nucleic acid. It stores genetic information. DNA is the polymer of deoxyribonucleotides.…

Q: For many years, wetlands were considered to be "wasted land", where 50% of wetlands in the U.S.…

A: Wetlands are the places where the soil is covered by water either salt or fresh. It may be…

Q: What molecules do the following digestive enzymes help to break down? (a) amylase, (b) invertase,…

A: Introduction :  Catalysts speed up chemical reactions without getting consumed or getting changed…

Q: Which WBC count represents leukocytosis?   A.)3500   B.)8700   C.)12,400   D.)6600

A: White blood cell count ( WBC) indicates the number of fighting cells that are necessary for immunity…

Q: Please explain the role of the SRP, SRP receptor and the protein translocator in the synthesis of a…

A: After the proteins has been translated, it needs to be send to different areas in the cells to carry…

Q: What are two advantages of using mice as a model organism rather than yeast?

A: A model organism is a species of plant, animal, or microbe that is widely used as a reference for…

Q: 2- Direct DNA modifications are maintained mostly by. Acetylation b) Methylation C) Hydroxylation d)…

A: Cytosine is one of the four nucleo-bases that is found in DNA and RNA. The remaining three are…

Q: Consider the following graph depicting the population growth of bacteria in an "ideal" laboratory…

A: Introduction :  Bacteria are prokaryotic unicellular organisms. They are found in different habitats…

Q: There is a situation in which a gene has five exons. Please draw four possible mature products of…

A: Alternative splicing is a biological process that involves the joining of exons from the same gene…

Q: in a scientific experiment, must always be held constant. Question 10 options:…

A: There are four categories of variables in a scientific experiment: independent, dependent, control,…

Q: 1. DNA is which macromolecule? 2. What is the monomer of this macromolecule? 3. What are the three…

A: DNA and RNA are the nucleic acids that can be found in cells. While RNA can be present in both the…