Match the protein on the left with the mechanism of how the protein is activated on the right. Beclin-1 XBP-15 Rheb LC3 IRE-1 [Choose] [Choose] Phosphorylation Binding another protein to form a complex Dephosphorylation Cleavage Binding of GTP Dimerization Splicing in cytoplasm [Choose] [Choose]

Match the protein on the left with the mechanism of how the protein is activated on the right. Beclin-1 XBP-15 Rheb LC3 IRE-1 [Choose] [Choose] Phosphorylation Binding another protein to form a complex Dephosphorylation Cleavage Binding of GTP Dimerization Splicing in cytoplasm [Choose] [Choose]

Name: Match the protein on the left with the mechanism of how the protein i
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Match the protein on the left with the mechanism of how the protein is activated on the right.Beclin-1XBP-1sRhebLC3IRE-1[Choose][Choose]PhosphorylationBinding another protein to form a complexDephosphorylationCleavageBinding of GTPDimerizationSplici

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 15P

See similar textbooks

Similar questions

Which factor has NOT been shown to play a role in determining the specificity of protein kinases? a. protein tertiary structure b. protein quaternary structure c. primary sequence at phosphorylation site d. disulfide bonds near the phosphorylation site e. residues near the phosphorylation site
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
Predict the location(s) (intracellular or extracelular) and a brief description of WHY based on your knowledge of the transport processes in the following constructs. Assume a start codon is present and include any proteolytic processing that would be likely. 1. A PTS1 C-term peroxisomal targeting seq added to C term of a normally secreted protein with usual N -terminal signal sequence 2. Adding of N-terminal mitochondrial targeting sequence to protein with internal nuclear localization seq. 3. Adding N-terminal signal sequence of secreted protein to N-terminus a mitochondria matrix protein precursor with mitochondrial targeting sequence still present
The figure from Moore (2020) shows a G protein-coupled receptor in a membrane. Note that "out" means outside the cell and "in" means facing the cytoplasm. The three amino acids "DRY" in loop I2 are required for protein targeting. What is the name of this kind of sequence, and what is its function? What protein targeting sequence is no longer included in this diagram? Why? The sequence "QXXNK" (where X is any amino acid) found in loop I3 has been identified based on its enzymatic activity. What is this activity? What particular domain would you expect to find in either Loop E1, E2, or E3? The gene that codes for this protein is a member of a family of genes that has arisen over evolutionary time. If you compared several of the genes in this family, would you expect their sequences to be most homologous (similar) in the region you describe in #3 above or #4 above? Why?
The gene for a eukaryotic polypeptide 300 amino acid residues Iong is altered so that a signal sequence recognized by SRP occurs at the polypeptide's amino terminus and a nuclear localization signal (NLS) occurs internally, beginning at residue 150. Where is the protein likely to be found in the cell?
What would most likely occur to nuclear-cytoplasmic shuttling if the intrinsic GTPase activity of RAN was slowed down by 50%? Group of answer choices RAN would not bind exportin and proteins would accumulate in the nucleus All of the answers are likely None of the answers are likely Importin beta would not release from RAN in the cytoplasm and nuclear import would slow down RAN would not bind to importin beta and protein cargo in the nucleus would not release
A peptide with the sequence AELQAKSAIAHELQAKAAIAHA is treated with ATP while in the presence of kinase An alpha helix is formed with the phosphorylated at pH 5 In the direction of the helix axis, what is the length of the helix
A protein complex in the nucleus is responsible for transporting mRNA molecules into the cytoplasm. Describe the proteins that form this exporter. What two protein groups are probably behind the mechanism involved in the directional movement of the mRNP and exporter into the cytosol?
An SH2-containing protein contains a mutation that changes its binding pocket such that tyrosine and phosphotyrosine bind with equal afﬁnity. As a result, MEK activity: does not change with receptor dimerization and transautophosphorylation decreases due to changes in Raf activation increases with ligand binding-induced dimerization decreases due to allosteric inhibition of SH2-domain binding
For each of the following, describe the path the protein takes to its final destination in the cell.Drawings are strongly recommended! If you need more space, you can use a separate sheet ofpaper. Proteins: 1) Hedgehog (released from the signaling cell), 2) Smoothened, 3) Ci/GliYour answers should include the following if they apply for each protein:o Sorting sequences and how the protein knows where to go at each step (what recognizesdifferent sorting sequences/tags). How/when the protein is inserted into the membrane (if it is a membrane protein) What organelles the protein passes through on its way to its final destination. How the protein is transported (vesicles? translocons? etc.), including a role for microtubules.How the protein might be modified in each organelle it passes through. What other proteins are involved in transport and how the system is reset to allow for otherproteins to be transported.
Caspases are involved in ___. Select one: a. protein dephosphorylation b. programmed cell death c. cell division d. redox status of proteins e. protein synthesis
As we learned when studying protein trafficking, proteins need a nuclear localization signal in order to move from the cytosol into the nucleus via the nuclear pore complex. Protein A contains a typical nuclear localization signal but surprisingly is usually found in the cytosol. When the cell is exposed to a certain hormone, protein A moves from the cytosol into the nucleus, where it turns on genes involved in cell division.When you purify protein A from cells that have not been treated with the hormone, you find that protein B is always complexed with it. To determine the function of protein B, you engineer cells lacking the gene for protein B. You compare normal and gene B deletion cells by separating and isolating the proteins found in the cytoplasm and those found in the nucleus. You then run these proteins on a protein electrophoresis gel to separate them by size. You identify the presence of protein A and protein B by looking for their characteristic bands on the gel (which is…