Predict the location(s) (intracellular or extracelular) and a brief description of WHY based on your knowledge of the transport processes in the following constructs. Assume a start codon is present and include any proteolytic processing that would be likely. 1. A PTS1 C-term peroxisomal targeting seq added to C term of a normally secreted protein with usual N -terminal signal sequence 2. Adding of N-terminal mitochondrial targeting sequence to protein with internal nuclear localization seq. 3. Adding N-terminal signal sequence of secreted protein to N-terminus a mitochondria matrix protein precursor with mitochondrial targeting sequence still present

Predict the location(s) (intracellular or extracelular) and a brief description of WHY based on your knowledge of the transport processes in the following constructs. Assume a start codon is present and include any proteolytic processing that would be likely. 1. A PTS1 C-term peroxisomal targeting seq added to C term of a normally secreted protein with usual N -terminal signal sequence 2. Adding of N-terminal mitochondrial targeting sequence to protein with internal nuclear localization seq. 3. Adding N-terminal signal sequence of secreted protein to N-terminus a mitochondria matrix protein precursor with mitochondrial targeting sequence still present

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter31: Completing The Protein Life Cycle: Folding, Processing, And Degradation

Section: Chapter Questions

Problem 9P

See similar textbooks

Similar questions

In eukaryotic cells secreted proteins are targeted first to the endoplasmic reticulum and then pass through the Golgi, before being released from secretory vesicles into the extracellular space. A much simpler route would be for ribosomes synthesising secretory proteins to be targeted to a translocon in the plasma membrane, with the protein being secreted directly as it is translated. List three potential advantages of the former, more circuitous, route for protein secretion over the simpler, more direct, alternative route suggested.
Keeping in mind the circular genome of Mitochondria identify the non-coding regulatory region in Mitochondria. What is its translational status? What regulatory function it performs?
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
A protein complex in the nucleus is responsible for transporting mRNA molecules into the cytoplasm. Describe the proteins that form this exporter. What two protein groups are probably behind the mechanism involved in the directional movement of the mRNP and exporter into the cytosol?
As we learned when studying protein trafficking, proteins need a nuclear localization signal in order to move from the cytosol into the nucleus via the nuclear pore complex. Protein A contains a typical nuclear localization signal but surprisingly is usually found in the cytosol. When the cell is exposed to a certain hormone, protein A moves from the cytosol into the nucleus, where it turns on genes involved in cell division.When you purify protein A from cells that have not been treated with the hormone, you find that protein B is always complexed with it. To determine the function of protein B, you engineer cells lacking the gene for protein B. You compare normal and gene B deletion cells by separating and isolating the proteins found in the cytoplasm and those found in the nucleus. You then run these proteins on a protein electrophoresis gel to separate them by size. You identify the presence of protein A and protein B by looking for their characteristic bands on the gel (which is…
A current focus of molecular medicine is to trigger or promote apoptosis of specific cells. several components of the apoptotic pathways are being targeted using this approach. for following, state specifically how the treatment would be expected to stimulate or inhibit apoptosis. c. Treatment of cells with organic compounds that enter the cell and bind with high affinity to the active site of Caspase-3
With reference to named examples, give a detailed account of the molecules and processes involved in trafficking soluble and membrane proteins from the Trans Golgi Network (TGN) to lysosomes. Include in your answer an explanation of how the trafficking machinery is recycled back, to the Trans Golgi Network in each case.
The figure from Moore (2020) shows a G protein-coupled receptor in a membrane. Note that "out" means outside the cell and "in" means facing the cytoplasm. The three amino acids "DRY" in loop I2 are required for protein targeting. What is the name of this kind of sequence, and what is its function? What protein targeting sequence is no longer included in this diagram? Why? The sequence "QXXNK" (where X is any amino acid) found in loop I3 has been identified based on its enzymatic activity. What is this activity? What particular domain would you expect to find in either Loop E1, E2, or E3? The gene that codes for this protein is a member of a family of genes that has arisen over evolutionary time. If you compared several of the genes in this family, would you expect their sequences to be most homologous (similar) in the region you describe in #3 above or #4 above? Why?
Genetic testing of a 29-month-old boy shows a mutation in the Phe residue at position 508 in the cystic fibrosis transmembrane conductance regulator (CFTCR) gene. Cultured skin fibroblasts from the boy contain an abnormal form of CFTCR protein bound to ubiquitin. Which of the following structures is the most likely site of elimination of these abnormal proteins in this patient? A) Endoplasmic reticulum B) Endosome C) Golgi complex D) Lysosome E) Proteasome
How a glycoprotein is translated, modified and ultimately transported to the outer plasma membrane. Be sure to explain the migration of the protein from the beginning of translation to placement in the cellular membrane. Describe an experiment that might be conducted to determine if any specific signal is necessary for the proper targeting of the ER or the plasma membrane.
Briefly describe the following properties of the Rab and Arf GTPases: a) Size, structure and cellular localization (for structure I want to know if they are lipidated and any other unique features) , b) How are they activated and inactivated (i.e. include the GEFs and GAPs), c). Give an example of downstream cellular effects.
In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then via the Golgi, where they are released into the extracellular environment through secretory vesicles. A more easier way would be for secretory protein-producing ribosomes to be localised to a translocon in the plasma membrane, with the protein being secreted directly during translation. Consider three possible benefits of the more roundabout method for protein secretion versus the simpler, more straightforward approach indicated.