Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA was originally labeled with 15N. Then 15N-labeled DNA was duplicated in the presence of 14N- nucleotides. It was found that the second- generation daughter DNA (after two rounds of replication) consists of O a. O b. O C. O d. e. all ¹4N-DNA 50% of hybrid 15N-14N DNA and 50% ¹5N-DNA all 15N-DNA 50% of hybrid 15N-14N DNA and 50% ¹4N-DNA all hybrid 15N-14N DNA

Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA was originally labeled with 15N. Then 15N-labeled DNA was duplicated in the presence of 14N- nucleotides. It was found that the second- generation daughter DNA (after two rounds of replication) consists of O a. O b. O C. O d. e. all ¹4N-DNA 50% of hybrid 15N-14N DNA and 50% ¹5N-DNA all 15N-DNA 50% of hybrid 15N-14N DNA and 50% ¹4N-DNA all hybrid 15N-14N DNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

Wild-type E. coli takes up and concentrates a certain redfood dye, making the colonies blood red. Transposonmutagenesis was used, and the cells were plated on fooddye. Most colonies were red, but some colonies did nottake up dye and appeared white. In one white colony, theDNA surrounding the transposon insert was sequenced,with the use of a DNA replication primer identical withpart of the end of the transposon sequence, and the sequence adjacent to the transposon was found to correspond to a gene of unknown function called atoE, spanning positions 2.322 through 2.324 Mb on the map(numbered from an arbitrary position zero). Propose afunction for atoE. What biological process could be investigated in this way, and what other types of white colonies might be expected?
On further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.
In Noll’s experiment to test the beads-on-a-string model, exposure of nuclei to a low concentration of DNase I resulted ina. a single band of DNA with a size of approximately 200 bp.b. several bands of DNA in multiples of 200 bp.c. a single band of DNA with a size of 100 bp.d. several bands of DNA in multiples of 100 bp
In the Meselson–Stahl experiment thatestablished the semiconservative nature of DNA replication,the extraction method produced short fragments of DNA. Whatsort of results might have been obtained with longer piecesof DNA?
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
What result would Meselson and Stahl have obtained if the replication of DNA were conservative (i.e., the parental double helix stayed together)? Give the expected distribution of DNA molecules after 1.0 and 2.0 generations for conservative replication.
In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging strand prior to the action ofDNA polymerase I. The lagging strand contains three Okazakifragments. The RNA primers, which are shown in red, have not yetbeen removed. A. Which Okazaki fragment was made first, the one on the left orthe one on the right?B. Which RNA primer will be the first one to be removed by DNApolymerase I, the primer on the left or the primer on the right?For this primer to be removed by DNA polymerase I and for thegap to be filled in, is it necessary for the Okazaki fragment inthe middle to have already been synthesized? Explain.C. Let’s consider how DNA ligase connects the left Okazaki fragmentwith the middle Okazaki fragment. After DNA polymerase Iremoves the middle RNA primer and fills in the gap with DNA,where does DNA ligase function? See the arrows on either sideof the middle RNA primer. Is ligase needed at the left arrow, atthe right arrow, or both?D. When…
a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated from the two tissue types, to be the same? Why? b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regard to their origin (s) of replication.
Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?
Suppose that 28% of the nucleotides in a DNA moleculeare deoxythymidine 5′- monophosphate, and that duringDNA replication the percentage amounts of availablenucleotide bases are 22% A, 22% C, 28% G, and 28% T.Which base would be depleted first in the replicationprocess?
If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'
In the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one light strand and one heavy strand ("hybrid") after one generation of growth in medium containing 14N? After two generations of growth in a medium containing 14N? What fraction of hybrid DNA is expected after n generations of growth in a medium containing 14N?