(mg) |(mg/fl oz) 55 4.6 38 1.9

Q: Describe and explain the necessary changes that health systems worldwide must undergo to improve ada...

A: Introduction :- Healthcare system is a system consisting of institutions ( like hospitals, dispensar...

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...

Q: Differentiate sterilization from disinfection.

A: Methods to remove unwanted microbes from the surfaces, clothes, and bodies are important. Disinfecti...

Q: Which of the following are amniotes? Choose all that apply. Fish O Amphibians O Reptiles Birds Mamma...

A: This specialised membrane structures of certain tissues formed outside of the body of the embryo whi...

Q: . A 20-year-old woman collapses at a wild party several hours after taking ecstasy. Which one of the...

A: Ecstacy is a psychoactive drug, meaning consumption of it has an effect on the functions of brain. I...

Q: Which of the following are jawless? Choose all that apply. O hagfish O lampreys O bony fishes O cart...

A: Jawless organisms are belongs usually to class Agnatha and primitive in nature. 

Q: for the virulence of a phage. A bacteriophage solution of a given concentration is inoculated with t...

A: Virulence of a phage: it is the ability of a virus to infect and cause their effect to the host orga...

Q: The normal level of calcium in blood ranges from 8.5 to 10.2 mg/dL. It must be tightly controlled. M...

A: Hormones are biological compounds secreted by neurosecretory or endocrine glands that help to mainta...

Q: Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other biom...

A: Introduction: The given diagram depicts the production of peptide bonds, which are responsible for t...

Q: Describe alleles and why they occur on homologous chromosomesof sexual reproducers

A: The term "chromosome" is derived from the Greek word for "color (chroma) and body (soma)." Thread-li...

Q: Plants use the proton electrochemical gradient across the vacuole membrane to power the accumulation...

A: Plant cells have vacuoles that accumulate excess salts and water.  

Q: Auditory neural signals are sent when HAIR CELLS in our inner ears open ion channels along their pla...

A: The fluid that surrounds the hair cells, known as endolymph, is high in potassium. When the hair cel...

Q: You are part of the radiology team at an ER.  A 6 year old child comes in, who may have a broken bon...

A: Interpretation of the broken bone X-ray 

Q: A 22-year-old pregnant woman at 20 weeks of gestation comes to her OB/GYN for a scheduled prenatal e...

A: The correct option is B. ( 4-6 weeks )

Q: According to optimal foraging theory... organisms will have a tendency to select the smallest prey a...

A: Optimal Foraging theory is a behavioural model of ecology which helps to predict the animal behaviou...

Q: Which part of this inner ear labyrinth has otoliths that roll over gel-topped sensory cells to send ...

A: The ear is divided into three parts viz., inner ear , middle ear and outer ear. The inner ear is als...

Q: 2- Supposed that you have a DNA sequence sample with 10,000 bp. By using 2 different restriction enz...

A: The answer is 3.

Q: What effect do sodium, caffeine, and alcohol have on calcium levels in the body?

A: The human body is made up of everything that makes you, you. Our genetic information determines and ...

Q: Describe the mode of action beta-lactam, aminoglycosides, polyenes, and quinolone antimicrobial agen...

A: Antimicrobial agents are defined as a substance that either kills or inhibits the growth of microorg...

Q: Coral reefs are being threatened and/or damaged by all of the following, except discharge of industr...

A: A coral reef is an underwater surrounding characterized by using reef-constructing corals. Coral ree...

Q: Some organisms—for example, certain fungi—reproduce asexually when the environment is favorable and ...

A: A fungus is any individual from the gathering of eukaryotic living beings that incorporates microorg...

Q: 6 Question 6 ECM lysosome flagellum microtubule centrosome rough ER smooth ER nucleolus nuclear pore...

A: A diagram of animal cell is given. Have to label various organelles and parts of animal cell.

Q: If a person reaches a BAC of 0.060% and then stops drinking, we would estimate that all alcohol woul...

A: Introduction :- Blood alcohol levels are decided by the blood alcohol concentration calculator . It ...

Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...

A: The correct option is C.

Q: _____ are characteristic of cancer. a. Malignant cells b. Neoplasms c. Tumors

A: Introduction :- Cancer is a disease that occurs when cells divide uncontrollably and spread into nea...

Q: Question 34 Carotenoids and chlorophyll would have two different absorbance spectra. O True O False ...

A: I gave you all the answer in Step 2 

Q: What is the value of mitochondrial fission and fusion?

A: Mitochondria is a double membrane-bound organelle.

Q: dogs have a diploid chromosome number of 78. Howmany chromosomes do their gametes have?a. 39 c. 156b...

A: Diploid refers to the number of complete chromosome sets present in each cell of an organism. Diploi...

Q: Explain the cell division limit and its fail-safe function

A: Introduction  Almost all cells in the body can divide and form new daughter cells however, there are...

Q: True or False : If a mutation occurs in gene can this can lead to one amino acid change in protein w...

A: The DNA is the genetic material that is being transcribed into mRNA and this mRNA is translated into...

Q: Which describe the similarities and differences in the composition of DNA and RNA? a.)In DNA Thymine...

A: 13 -correct option is - b.)In DNA Thymine paired with Adenine (T - A): In RNA Adenine paired with Ur...

Q: Name the main benefit that vascular tissue provides to land plants. Explain how vascular tissue bene...

A: In land plants, vascular tissues can be observed. These tissues include xylem and phloem. The compon...

Q: Homologous chromosomes_____ . a. are inherited from two parents b. are sister chromatids c. are diff...

A: Chromosomes are the structures that become visible during cell division only.  

Q: which cellular function is performed by only some types of cells? obtaining nutrients and chemical ...

A: Cells must perform functions in order to support and maintain life, that is cellular functions, such...

Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...

A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...

Q: 28. During respiration, most ATP is formed as a direct result of the net movement of (A) potassium a...

A: Synthesis of ATP occurs through aerobic cylinder respiration in the mitochondria. The enzyme ATP syn...

Q: 2. Describe how an individual's genotype influences their chance of contracting malaria: Which indiv...

A: Introduction :- Genotype is defined as the sum total of all the genes , specifying the phenotypes or...

Q: 8. The process of arranging organisms into similar or related groups, primarily to make it easier to...

A: Classification is the process in which the organisms are arranged into similar or related groups

Q: The ADP/ATP carrier, which exchanges cytoplasmic ADP and mitochondrial ATP, can also function as a p...

A: Answer :: a) Proton pumping rate, electron transport rate, rate of oxygen uptake : remains the same ...

Q: d) Since we know this bacterial organism thrives in colder areas of the world, what can be said abou...

A: NOTE: We are solving parts d and e as mentioned by you. Bacteria that can survive cold temperatures ...

Q: The Calvin cycle reactions that fix CO2 do not function in the dark. What are the likely reasons for...

A: The carbon cycle can be described as the series of reactions associated with fixing carbon dioxide (...

Q: Can a monohybrid cross be used to illustrate Mendel’s principle of independent assortment?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: Which is a characteristic of pseudoscience or bad science? a) Considers evidence for and against a h...

A: Pseudoscience comprises explanations, beliefs, or practices that case to be both logical and authent...

Q: Compare andcontrastmajor approaches inenvironmental ethics

A: Environmental ethics is a branch which deals with the studies of conceptual foundations of environme...

Q: What is the importance of Recombinant DNA Technology in the Molecular Laboratory

A: Recombinant DNA technology- Recombinant DNA technology is the joining of two different DNA molecules...

Q: therefore, humans should immediately set a date for their relocation to Mars where, with proper plan...

A: Solution : We have known for some time that the journey to Mars for humans would be hard. It’s expen...

Q: Which of the following is an example of allosteric regulation? A. the binding of CAMP-CAP to DNA B. ...

A: Allosteric regulation is a form of regulation where enzymes or molecules are regulated by binding to...

Q: were crossed. The F1 colored, full plants were crossed to a colorless and shrunken tester strain. Th...

A: Genes are not segregated independently because progeny is not in 1:1:1:1 ratio. 

Q: What additive ingredients are thickeners? Total Fat Sat. Fat Cholesterol Sodium Total Carbohydrate D...

A: Out of the option given all are used as thickeners except caramel colour. Caramel colour is a sugar ...

Q: The reactants and products of the light reactions. Explain how light supports the light reactions wi...

A: According to our guidelines we can answer only the first three subparts of the question. So, please ...