Model Genetic Organisms: Why are fruit flies considered a model genetic organism? Would humans fit this description?

Q: compensation in genetics

A: Genetics is subfield of biology. It deals with the study of genetic variations and heredity in…

Q: Explain why the genetic code is said to be redundant and virtually universal? How these features may…

A: Amino acids are building blocks of proteins. They are a set of rules that governs how codons are…

Q: Define exon shuffling and explain why its occurrence might be an evolutionary advantage.

A: Gene expression is the process by which the instructions in the DNA are converted into a functional…

Q: Describe several uses of genetic engineering in human medicine.

A: The genes are formed by the Deoxyribonucleic acid (DNA) of an organism. These genes code all of the…

Q: Explain why there is redundancy in the genetic code but no ambiguity.

A: Redundancy: One amino acid is coded by more than one triplet codon. Ambiguity: One triplet codon…

Q: describe DNA Variation in a Genome

A: The DNA is the genetic material that is passed from one generation to the next generation. It is…

Q: Explain Molecular Chaperones.

A: Biomolecules are organic compounds found in living organisms. All living organism will have these…

Q: Which molecular systems can be/have been engineered by molecular programming? Write the logic behind…

A: The   molecular programming as offering new ideas and approaches to major problems in biology ,…

Q: Briefly explain how gene expression occurs at the molecular level.

A: Genes are the basic biological unit of heredity. They are a segment of deoxyribonucleic acid (DNA)…

Q: Briefly describe a summary of the flow of genetic information in cells with diagram.

A: Gene expression is that the method the cell uses to provide the molecule it desires by reading the…

Q: Explain about Transcriptomics ?

A: A transcriptome is a set of transcripts of all RNA including non-coding and coding in the individual…

Q: Explain genetic engineering and its process

A: The term genetic engineering which is also known as genetic modification or manipulation is a field…

Q: Give an example of genetic engineering and explain the genetic change involved in the process.

A: Genetic engineering are the process involved in change in genetic make up of organism via…

Q: s genetic engineering a curse or blessing?

A: Genetic engineering is the process of using recombinant DNA technology (rDNA) to alte the genetic…

Q: Genome size varies considerably among multicellular organisms. Is this variation closely related to…

A: Genes contain sequences of nucleotides which are present on chromosomes. Genome complexity consists…

Q: a) Explain the difference between a genome and a transcriptome. Do all cells in an organism have the…

A: The branch of biology includes the study of genes, their variation, and inheritance in organisms.…

Q: Justify why information on functions of human genes can often be acquired through studies of simple…

A: It is a species that has been widely studied,  usually because it is easy to maintain and breed in a…

Q: (Reasoning) What are two discovered uses of noncoding DNA (introns)?

A: Introns are non coding DNA sequences which do not encode for proteins.

Q: Please answer fast What is the importance of a catalog of mutant strains for a particular genetic…

A: Mutation is the first and foremost step in evolution. It creates new DNA sequences and ultimately…

Q: Create an analogy for the process of gene expression. In your analogy, be sure to explain the…

A: The genes are located on the chromosomes and it is the part of DNA sequence that ultimately produce…

Q: How would you introduce the change/modification into the skin cells to transform them into neurons?

A: Every cell in an organism's body contain the same genetic material and genome. It is due to the…

Q: Discuss an example of a human gene and the function of the particular protein molecule it codes for?

A: A gene is composed of sequence of DNAs, and each gene is transcribed to form an mRNA. Exons are…

Q: How might you provide evidence that DNA is the genetic materialin mice?

A: DNA is the genetic material, it was confirmed by Griffith's experiment. This experiment was…

Q: Briefly explain differences in DNA and RNA genomes

A: A cell contains a nucleus inside which the genome is present. The genome represents all the genes…

Q: Describe the science behind genetic engineering andevaluate the public debate over its use

A: Recombinant DNA technology is a process that joins together genes from different species and the…

Q: The type of model building used by Pauling and by Watson andCrick involved the use of ball-and-stick…

A: Molecular modelling is the collection of all theoretical methods and computational techniques that…

Q: Explain Exceptional genetic codes?

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: EXPLAIN The Genetic Code Is Almost,but Not Quite, Universal?

A:

Q: Can you explain this dna model

A: DNA is made up of sugar ( deoxyribose) , nitrogenous bases ( thymine, cytosine, adenine and guanine)…

Q: Which statement about the flow of genetic information is true?   a. RNA encodes information that…

A: DNA or deoxyribonucleic acid is the genetic material of most of the organisms that is present within…

Q: Write your own version of an abstract for Avery, Macleod and McCarty's landmark genetics experiment.…

A: Frederick Griffith conducted a series of experiments with Streptococcus pneumonia (bacterium…

Q: Are mutations good or bad? Explain your answer

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: Discuss 3 influences/studies in Genetic and Biochemistry in relation to Molecular Biology.

A: Answer: Introduction: In recent research these disciplines closely interlink. Therefore genetics…

Q: Explain how transposons and retrotransposons move to new locations in a genome.

A: The transposable elements (TEs) are the jumping deoxyribonucleic acid (DNA) sequences.

Q: In a complex multicellular animals and plant cells, where is DNA found?

A: DNA is the genetic material for both plants and animals. The DNA is self-replicating and replicates…

Q: List and describe the processes that make up the central dogma of biology which provides the path…

A: Central dogma is the process in which the genetic information flows from DNA to RNA, to make a…

Q: Explain why genomic libraries are useful

A: Genomic library is defined as the collection of all the genes that can be isolated from an organism.…

Q: Using specific examples that have happened in your lifetime, distinguish between a spontaneous…

A: Mutation - Mutation is an alteration in the nucleotide sequences of the genome of an organism,…

Q: Imagine that you become a parent in an age when a full genetic workup is available for every baby.…

A: A genetic testing is usually performed if one's pregnant or thinking of getting pregnant, to have a…

Q: What is molecular biology?

A: Biology is the study all kind of living organisms and its processes that can be divided into several…

Q: Describe the science behind genetic engineering

A: Genetic engineering is the process of using recombinant DNA (rDNA) technology to alter the genetic…

Q: Explain a powerful methodology for studying gene expression ?

A: The functions of a gene can be studied by looking at how it expresses in a specific cell and how it…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Explain the two CONS of Genetic Engineering.

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Explain how the sequence of a molecule of DNA, madeup of many monomers of only four possible…

A: Introduction  The genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.