Motulsky's arrangement. Follow the format bellow. ogel & Motulsky Arrangement Name of chromosome according to the position of centromere Description a

Q: Composition as a mole fraction of one of a double-stranded DNA strand T = 0.22 and C = 0.30. In the…

A: Nucleic acids are the units of DNA or gene or chromosome. Genetic variation occurs due to…

Q: ow using linkage? 50 million base pair human chromosome 100 million base pair human chromosome 150…

A: Genetic mapping, also known as linkage mapping, can provide solid proof that an illness passed down…

Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…

A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…

Q: Describe the structure of nucleosome ( please keep it short as much as you can ).

A: A nucleosome is a basic structural unit of eukaryotic chromatin . It consists of approximately 150…

Q: Tick ​​the correct statements:   Remember: Tautomers are structural isomers that differ from each…

A: Ans). The first statement, the third statement, and the fourth statement are correct. Explanation:…

Q: Write TRUE/FALSE in number 6,7,8,9,10 ____6. “ Prokaryotic ribosomes is made of 40S and 60S…

A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…

Q: Questión 13 Which of the following DNA parts actually refers to a six -membered heterocyclic ring? A…

A: DNA and RNA are macromolecules that make up nucleic acid. DNA (Deoxyribonucleic acid) is a genetic…

Q: How is the mechanism of excision repair similar to that of mismatch repair?

A: Excision and inconsistent repair each square measure used for the repairing the broken polymer…

Q: Please explain it simply, and don't over-explain. Thanks!

A: DNA is a genetic material that regulate all functions and character of our body. It condensed to…

Q: Analyzing: Each nucleotide in a DNA molecule consists of a: * sulfur group, deoxyribose, and a…

A: 1.

Q: Give one chromosome and show its value after mutation - 8 Quean problem

A: Chromosomal mutation is an unpredictable changes occurs in chromosome.  It occurs either changes…

Q: Each _________________- chromosome contains (prior to itsreplication) a single molecule of linear,…

A: during nuclear division, the nuclear material which is the chromatids double in number. they…

Q: TRUE OR FALSE] 11. The structure of the DNA, being super coiled, promotes increased viscosity of…

A: Nucleic acid was first discovered by Friedrich Miescher from the nuclei of the pus cells…

Q: Which is NOT true of the different conformations of DNA?     A. Z-DNA is a left-handed spiral.…

A: A-DNA: right-handed double helix. Dehydrated B-DNA takes an A type that, during severe conditions…

Q: An enzyme is needed for the Krebs Cycle.  It will be made following the directions contained in a…

A: In eukaryotes, the genetic information needed for all cellular processes is encoded by genes, which…

Q: 34. Chromatin is composed of roughly equal amounts of DNA and proteins called histones. Nucleosome…

A:

Q: In nucleosomes, DNA wrapped around octamar of histone proteins O False True

A: A histone octamer is the eight protein complex found at the focal point of a nucleosome center…

Q: Matching Type Choose the directionality of the given process. (4 points) What is the directionality…

A: Directionality is the property of being directional or maintaining a direction in general terms.…

Q: Illustrates a Model of Replication Fork Instructions for Making a Model of the Replication Fork 1.…

A: DNA is vital for all living beings – even plants. It is important for inheritance, coding for…

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…

Q: Match term and its description. heat briefly separate DNA strands |Choose cool to allow primers to…

A: PCR ( polymerase chain reaction ) is a methodology involving synthesis of numerous duplicates or…

Q: Which of the mechanisms efficiently and effectively organize the DNA into a usable form?…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…

Q: True/false? if false, justify briefly   The bacterial nucleoid comprises linear nucleic acid…

A: The genetic material of the cells is contained in the DNA which has the blueprint for the synthesis…

Q: Some chromatin remodeling factors use energy from ATP hydrolysis to slide nucleosomes.shifting…

A: Chromatin remodeling can significantly alter gene expression. It is studied under the domain of…

Q: Which statements are true? Explain why or why not.1 Because the DNA double helix is only 2 nm…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: Replication Centromere O Unreplicated, homologous Replicated, homologous O Unreplicated, identical…

A: According to the question, in the following image C and D are ........... and ..............…

Q: Modified True or False: Write TRUE if the statement is correct, if the statement is false, change…

A: Note: Since we only answer up to three sub-parts, we’ll answer the first 3. Please resubmit the…

Q: What length of DNA (based on the number of subunits) has a potential diversity close to 3 *10^16?

A: The length of the DNA is determined by corresponding to the base pairs in the DNA and the distance…

Q: nce of Bacteriophage.

A: The Significance of Bacteriophage:

Q: Describe the base-pair rule. - What three things make up a nucleotide? - What does anti-parallel…

A: 1.Base pair rule: This rule in DNA states that purines (A,G) should bind with pyramidines (T,C) the…

Q: likely be able to bind a Cyclic AMP DNA binding protein? (only one strand is shown but assume DNA is…

A: CRP is a transcription factor that, when complexed with cAMP, binds DNA and activates transcription…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: Why DNA methylation needed for DNA replication ? * Your answer What is the general way for…

A: 1.  DNA methylation is the process of adding a methyl group to the DNA sequence. It helps in…

Q: Yes or no?   DAPI just stains dna in testes and sperm of planarian. A of riboprobe duryin situ…

A: Introduction :- DNA molecule acts as the genetic material of the cell and is made of polynucleotide…

Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…

A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…

Q: Nucleosome structure: Identify the proteins indicated by the arrow. Hint: there are two of these…

A: option -a)histone H2A-H2B diner is correct.

Q: True or false?  DNA repair mechanisms all depend on the existence of two copies of the genetic…

A: RNA polymerase is an enzyme that converts a DNA sequence into an RNA sequence via the transcription…

Q: Quick help Only cell biology Which process is described in the following paragraph? During DNA…

A: DNA contains the instructions for an organism's or cell's development, reproduction, and death. DNA…

Q: Tabulate the different classifications of Human chromosomes. Group them as well using "Vogel and…

A: Humans possess a total of 23 pairs of chromosomes, of which 22 pairs are autosomes, while the 23rd…

Q: I. Structure of a Chromosome Using the illustration in your activity sheet, label the parts of a…

A: Introduction Chromosomes are thread-like structures found within the nucleus of both animal and…

Q: Piecing it Together - Chargaff's data was a central piece of evidence used by James Watson and…

A: DNA  is the genetic component of the majority of living organisms. DNA contains the genetic…

Q: . Describe the structure and complementary base pairing of DNA.

A: DNA or deoxyribonucleic acid is  an important bio-molecule composed of polynucleotides and contains…

Q: What are heterochromatin and euchromatin?

A: Introduction - Chromatin, which is made up of DNA and protein, is the substance that makes up a…

Q: Human Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which…

A: Introduction :- Chromosomes are thread-like structures within the nucleus that securely wrap DNA.…

Q: 3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, S sugar and N…

A: DNA is a polymer of nucleotides which are linked to each other by 3'-5' phosphodiester bond.

Q: True/false? if false, justify briefly DNA synthesis during the S phase is extremely rapid. Cells…

A: The cell cycle is divided into four phases: S phase, M phase, G1 phase, and G2 phase. The cell cycle…

Q: In Figure 12-11b, in what chromosomal region are youlikely to find the most H1 histone protein?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.