Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.

Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.

Biochemistry

9th Edition

ISBN:9781305961135

Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Chapter9: Nucleic Acids: How Structure Conveys Information

Section: Chapter Questions

Problem 14RE: RECALL Which of the following statements is (are) true? (a) Bacterial ribosomes consist of 40S and...

See similar textbooks

Related questions

Q: 2) (recall) whlo is the coding one? A)UAG B)UGA C)UAA D) AUG E) none of the above 13)…

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.The…

Q: Question- You have a new microorganism that you have just isolated. You suspect your bacterium is…

A: By recycling cellulose, the foremost abundant carbohydrate generated by plants, cellulolytic…

Q: titration curve. Match each numbered arrow on the curve (from (1) to (5)) with the appropriate amino…

A: Amino acids have two functional groups namely carboxyl and amino group. When the pH is less than pKa…

Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (???? ?) in newly synthesized…

A: The DNA that makes the genetic material for all prokaryotes and eukaryotes is nothing but a code for…

Q: Red blood cells are normally circular in shape. Sickle cell anemia is a disorder that affects the…

A: sickle cell anemia is a genetic disorder caused by alternation in genetic sequence .

Q: Determining the amino acid sequence in a protein usually in- volves treating the protein with…

A: Treatment of a polypeptide with eleven amino acids with one reagent gives the following fragments :…

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5' 1. Determine the sequence…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: 1. Identify the gene from which the querysequence originates (Name of gene)

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: Structure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids…

A: β-lactam antibiotics are antibiotics that contain a beta-lactam ring in their chemical structure.…

Q: (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a…

A: Holliday junction is a four-strand DNA nucleotide strand that is formed during genetic…

Q: Base pairs Data – all had Temp = 250C PH = 7 Binding Constant A & X [A] = 0.00373221M [X] =…

A: The DNA double helix is made of two linked strands that are wound in a helical shape. The two…

Q: When large genomes are sequenced, which of the following is true? Group of answer choices The…

A: Genome is defined as the total complete set of an organism's DNA where it contains of all the…

Q: True or False. In a comparison between the DNAs of related organisms such as humans and mice,…

A: Conserved sequences in related organisms are compared by comparing their proteins.

Q: Problem B. DNA: Codon Segmenting The way that DNA is often interpreted as genes is in groups of…

A: An open reading frame (ORF) is the segment of DNA (deoxyribonucleic acid) sequence that can be…

Q: Calculation problem on genetics. What would be the formula?

A: The allele frequency is a measure of how common a gene variation is in a population. Alleles are…

Q: Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and…

A: Codons It refers to the sequence of three consecutive nucleotides that are present in the DNA or RNA…

Q: 1)(recall) Which of the following SEQUENCES BEST DESCRIBES the flow of information thet take place…

Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (?????) in newly synthesized…

A: transcription is the process by which the dna molecules are converted into messenger rna molecule .

Q: A protein has a tertiary structure formed by interactions between the side chains of the following…

A: Two protein interacts with each other using side chain of interaction. Depending upon interacting…

Q: recall that DNA has bases A, C, G, and T. Suppose we invented a DNA2 genetic material that has bases…

A: DNA is the genetic material and stores the genetic information in the form of its nucleotide…

Q: 2. Using the standard 3.6 amino acids per turn (360°) and the helical wheel below, plot each…

A: Helical wheel plot is used to alpha helix of protein structure in 2D plane. This is helpful in…

Q: Simple problem-solving: Imagine you did a Bradford assay, and measured the absorbance of a set of…

A: Bradford assay is used to measure the protein concentration in the unknown samples. The standard…

Q: 3)(recall) Replication: what would be the CORRECT ORDER OF NUCLEOTIDES (? ?????) in the newly…

A: DNA is the deoxyribonucleic acid. It is a genetic material present in the nucleus.

Q: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST…

A: Q1. STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’ STAMENT 2:…

Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…

A: The X-ray diffraction is one of the analytical techniques in which the X-rays are used for analysis…

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…

Q: What is the average radius of a piece of double-stranded DNA in water that has a link length of 5.9…

A: f the link length of the double stranded DNA is 5.9nm so the complete length would be 17813445.2 nm…

Q: Define Shannon Entropy. Provide an example using a short 10-mer of DNA.

A: Entropy of a system is the order of randomness within the system. Shannon entropy in a biological…

Q: What name is given to the predominant secondary structure found in wool protein?

A: Because estimating tertiary structure only based on amino acid sequence may not be sufficient,…

Q: Good hand written explanation Asap Briefly describe the 2-dimensional and 3-dimensional structure…

A: Introduction tRNA or transfer RNA is a type of RNA molecule. It plays an important role in…

Q: V3 amino acid sequence molecular clone 296 306 314 320 324 charge S1 phenotype** 168.1 CTRPNNNTRKS…

A: The charge on the peptide or protein is due to the presence of acidic or basic amino acids. Acidic…

Q: Chargaff’s rules?

A: DNA's Base composition is governed by the relationships which are discovered by chargaff, known as…

Q: 9)(recall) During translation, what TYPE OF MOLECULE carries amino acid to the site of protein…

A: The explanation is given below for the above answers.

Q: Describe the base-pair rule. - What three things make up a nucleotide? - What does anti-parallel…

A: 1.Base pair rule: This rule in DNA states that purines (A,G) should bind with pyramidines (T,C) the…

Q: What is the predominant attractive force that stabilizes the formation of secondary structure in…

A: The levels of structural organization of a protein are its primary structure, secondary structure,…

Q: 23. Contrast the “functional” size of the four major classes of biomolecules. Background: Up…

A: Carbohydrates, proteins, lipids, and nucleic acids are the four major biomolecules. Carbohydrates…

Q: 1. A protein has a tertiary structure formed by interactions between the side chains of the…

A: The tertiary structure of a protein is stabilized by noncovalent interactions like hydrogen bonding,…

Q: Recall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein one complete 360 0…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: 7)(recall) In a nucleosome, the DNA is WRAPPED around A)ribosomes. B)histones. C)polymerase…

A: Ans- B. histones Explanation: Nucleosomes are the name for the beads. Each nucleosome is made up…

Q: Variable number tandem repeats (VNTRs) are repeating DNA sequences of about 15–100 bp in length,…

A: Forensic science. Criminological science is the use of science to criminal and common laws,…

Q: 17. How would you computationally predict the thermodynamic stability of a long, extended RNA helix?…

A: Thermodynamic stability is the state when the structure is in a conformation that has the lowest…

Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…

A: Fibroins are insoluble proteins that are present in silk produced by insects, such as the larvae of…

Q: A mixed copolymer was synthesized using 2 parts Cytosine and 1 part Adenine and the resulting mRNA…

A: In this question we have to describe about codon and its translating amino acids. See full answer in…

Q: Cordycepin (structure shown), a broad-spectrum antibiotic was used to treat a bacterial infection.…

A: Antibiotics are potent medications that fight infections and, when taken correctly, can save lives.…

Q: (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a…

A: In the above figure the sequences are arranged on the basis of complimentarity. Let's assume red…

Q: Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA double helix

A: * DNA is made up of double helical structure.which are complementary to each other and consist of…

Q: Purification of a new unknown protein that you isolated from tissue and Assume that you have reached…

A: Guanidium hydrochloride is one of the powerful denaturants. At higher concentration of guanidium-HCL…

Q: Hidden Markov Model (HMM) Construct the HMM for the following sequences

A: Introduction A hidden Markov model (HMM) is a statistical model which will be used to describe the…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

100%

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an â€œaverageâ€� human chromosome?
RECALL Which of the following statements is (are) true? (a) Bacterial ribosomes consist of 40S and 60S subunits. (b) Prokaryotic DNA is normally complexed with histones. (c) Prokaryotic DNA normally exists as a closed circle. (d) Circular DNA is supercoiled
RECALL Which of the following statements is (are) true? (a) The two strands of DNA run parallel from their 5' to their 3'ends. (b) An adeninethymine base pair contains three hydrogen bonds. (c) Positively charged counterions are associated with DNA. (d) DNA base pairs are always perpendicular to the helix axis.
REFECT AND APPLY Most proteins contain more than 100 amino acid residues. If you decided to synthesize a 100-mer, with 20 different amino acids available for each position, how many different molecules could you make?
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
DNA True or false A long chain polymer in which the internucleotide linkages are of the diester type between C-3’ and C-5’ Hydrolyzed by weak alkali (pH 9 to 100°C) Different from RNA since in the latter the internucleotide linkages are between C-2’ and C-5 Usually present in tissues as a nucleoprotein and cannot be separated from its protein component
Question:- Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.
DNA: Using the two deoxynucleotides you chose, draw the two monomers bound together into a compound, and label a phosphodiester bond.
Thinking about the complexity of biochemical systems as they relate to the human body and the specificity of DNA, why can we not describe the “average” behavior of a DNA molecule?
RECALL Why do we say that micro RNAs are involved in the oldest evolutionary relationship?
REFLECT AND APPLY DNA synthesis always takes place from the 5' to the 3' end. The template strands have opposite directions. How does nature deal with this situation?
REFLECT AND APPLY In the early days of molecular biology, some researchers speculated that RNA, but not DNA, might have a branched rather than linear covalent structure. Why might this speculation have come about?