The following RNA polymer is added to an E. coli extract, where it can be translated in all three possible reading frames. Which amino acids can be polymerized into polypeptides in this system? 5'-AUAUAUAUAUAUAUAUAUAUAUAUAUAU-3'
Q: I have four amino acids: serine, histidine, alanine, and tyrosine. How many different primary struct...
A: Proteins are composed of amino acids linked together by peptide linkages. T he primary structure of ...
Q: Given the following question on the image identify the following:1. Total number of acetyl coA molec...
A: Maltose is a carbohydrate and it gets oxidized through glycolysis in cytoplasm and through the TCA c...
Q: Why are some pathogens more noticeable than others?
A: A pathogen is an organism that causes disease in its host, with virulence referring to the intensity...
Q: 22. A mutant algae has some of its mitochondria missing with inner mitochondrial membrane. Which of ...
A: The inner mitochondrial membrane is the mitochondrial membrane separating the mitochondrial matrix f...
Q: E. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA. I...
A: Carboxylate relay One of the carboxylates ( Asp70) activates water molecule to release the hydroxyl ...
Q: The number of high-affinity binding sites in the T form of hemoglobin is _______ The number of low-a...
A: Hemoglobin T-state is described as deoxygenated state also called deoxyhemoglobin and have low affin...
Q: olarimeter is used to detect S
A: Polarimeter- is a scientific instrument used to measure the angle of rotation caused by passing pola...
Q: importance in familiarizing and knowing the uses of common laboratory
A: The question is all about the knowledge and familiarity of common laboratory equipments that is used...
Q: The following define nucleic acids EXCEPT А They are polyionic molecules of high molecular weight co...
A: Nucleic acids are Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
Q: Propose TWO (2) industrially important bacterial products for human needs with their respective proc...
A: Bacterial products been proven to be very beneficial for several industrial processes in manufacturi...
Q: Illustrate different types of lipids and relate their chemical structures to their role in the bioch...
A: Lipids are important to our body as they store energy, as well as they are required for cellular str...
Q: A solution with a pH of 2 has a hydrogen ion concentration that is _______________ the hydrogen ion ...
A: pH is a measure of the negative logarithm of the hydrogen ion concentration. Given Values: pH = 2.0...
Q: A protein P has two identical binding sites for a molecule A. The shape of the protein is dependent ...
A: The Scatchard Plot for a protein-ligand association help to determine the affinity and number of the...
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino ...
A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a pyrimi...
Q: The structural formula of propranolol, a common blood pressure medication, is shown below (left). To...
A: Propranolol is a popular Beta blocker used to treat high blood pressure and migraine. In order to re...
Q: Which of the following is true of DNA and RNA? both are found in the chromosomes neither DNA n...
A: DNA is the genetic material in an prokaryotic and eukaryotic cell.
Q: Define polyunsaturated fat
A: Lipids are major macromolecules comprised of carbon, hydrogen, and oxygen just like carbohydrates bu...
Q: Identify the type of isomerism exhibited by the following pairs of monosaccharides
A:
Q: 1-Strong acid should add to the solvent ( not the opposite). Why ?
A: Acids are chemical substances that give off hydrogen ions or protons when placed in a solution. Thus...
Q: Starting from formaldehyde, ammonia, hydrogen cyanide, carbon dioxide, ethene and water as needed, s...
A: 4.5 billion years ago our planate originate from the solar system. at 1st billion years...
Q: What biotechnology product that has improved life, and what would our life be without this product?
A: Biotechnology is a technology that uses living beings and biological processes to bring new solution...
Q: what percent of the grapes used to make the wine could be non-Cabernet Sauvignon?
A: Cabernet Sauvignon is one of the most recognised red wine grape variety which is a hybrid of the red...
Q: Using the data provided in the table, the estimated p50 for myoglobin is mmHg and the fraction satur...
A: Myoglobin (Mb) is an iron and oxygen binding protein that is present usually in the cardiac and ske...
Q: For the following, calculate pka, and pka, of 1 Glycine, determine the 2 buffering regions, and calc...
A: Glycine is an amino acid with H-atom as the side chain. The isoelectric point of a amino acid (pI) i...
Q: Dexaclomycin is an antibiotic that inhibits peptidoglycan formation. Given this information, what ty...
A: Gram-negative bacteria are surrounded by a thin peptidoglycan cell wall, and an outer cell membrane ...
Q: Under what conditions does Km represent the true binding affinity (i.e. Kd) of the substrate to the ...
A: Ans) option 1 is the correct answer. when kcat << k-1 km is the substrate concentrat...
Q: Chemically, Olestra is made of a six-carbon backbone and six fatty acid attachments. No nutrients ar...
A: Olestra- Indigestible fat and composed of 6 fatty acid attachments.
Q: An antibody (Ab) can bìnd to its antigen binding site (B) with a high affinity (large negative AG°)....
A: The antibodies bind to its antigen via non n covalent interactions like hydrogen bonding, hydrophobi...
Q: At a pH of 7.40, the carbonic acid ratio is, a. 35:1 b. 4:1 C. 20:1 d. 3:1
A: Given Values: pH = 7.4 pKa = 6.1
Q: What is the particular about the amino alcohol used in the synthesis of sphingomyelin?
A: Phospholipids: Phospholipids are compound lipids and it is of two types. These include glycerophosph...
Q: Suppose you received two cultures from a reactor biological: one containing a species of Gram negati...
A: All of life forms can be divided into three domains, based on the cell type: Bacteria, Archaea and ...
Q: how many ATP synthesized by oxidation of NADH by O2? Compare it with the ATP synthesized by oxidatio...
A: Electron transport through complexes I, III, and IV is coupled to the transport of protons out of th...
Q: Question 9 What is the most appropriate time to use a safety shower? 1) You spilled 400 milliliters ...
A: Safety shower: It is a device designed to wash off chemicals when it is spilled in a person. One ca...
Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O...
A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using...
Q: Indicate the contrast statements of the following chromatographic techniques of separation. A. A sep...
A:
Q: Why are polyunsaturated omega-3 fatty acids considered as good for our health? Explain such phenomen...
A: Fatty acids are important components of lipids. Fatty acids are composed of hydrocarbon chain and a ...
Q: CH3CH2OH +HCOOH
A: Alcohol reacts with many kinds of acid to form esters. When alcohol and carboxylic acid reacts, the ...
Q: 14. In which steps in glycolysis utilizes energy to catabolize glucose, and, steps that produces and...
A: Glycolysis is a conversion of six-molecule of glucose into two molecules of pyruvate with the format...
Q: Given the following question on the image identify the following:1. Total number of glucose molecule...
A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since ...
Q: Order the following from 1-12 events chronologically based on the next generation sequencing methodo...
A: Genome sequencing is a biotechnological technique which is prominently used in sequencing the genome...
Q: Examine the biochemical composition of a human body in the perspective of the various organic molecu...
A: The human body is composed of not only bones, organs, glands, and tissues but thousands of different...
Q: oxidation of NADH by nitrate produces 5 ATP, by H2S is 2 ATP, by O2 is 3 ATP. Why oxidation of NADH ...
A: An intact Krebs cycle is frequent in microbes that use anaerobic respiration, allowing them to utili...
Q: What are the 4 levels of structural organization of proteins and what are the important interactions...
A: The four levels of structural organization of proteins are : Primary structure, Secondary structure,...
Q: Ceramide is synthesized biologically from sphingosine. 1. What type of reaction in this synthesis re...
A: Ceramide is a type of lipid, which is composed of sphingosine and fatty acids. Ceramide forms glycol...
Q: . Relationship of Drug solubility & dissolution rate on Physico-Chemical Properties 2. Relationshi...
A: 1.Physicochemical properties: The ability of a chemical compound to elicit a pharmacological/ therap...
Q: COLOR REACTIONS OF PROTEINS AND AMINO ACIDS
A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group (...
Q: Experiment No. 2 AMINO ACIDS AND PROTEINS Data Solubility in water Sample Solubility (So...
A: Disclaimer: "Since you have posted a question with multiple subparts, we will solve the first three ...
Q: ased on the following qualitative tests for proteins, which one is positive/negative for intact prot...
A: Amino acid: Amino acids are building blocks of proteins and also act as an intermediate in metaboli...
Q: Enumerate the common tests employed to the following dosage forms and give the reason why the test i...
A: The various dosage form have to go through some test in order for them to be reagrded safe for use a...
Q: Complete the following paragraph describing the fate of the second 14CO-acetyl-CoA molecule incorpor...
A: The glyoxylate produced in the isocitrate reaction combines with 2nd molecule of acetyl coa in the m...
The following RNA
5'-AUAUAUAUAUAUAUAUAUAUAUAUAUAU-3'
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant ....CTTGCTAGCGAATC....The substitution shown seems to have created a stop codon. What further information do you need to be confident that it has done so?Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- Human wildtype and mutant alleles are identical in sequence except for a single base-pair substitution that changes one nucleotide towards the end of intron 2. The wildtype and mutant sequences of the affected portion of the mRNA are listed in the following table. Explain how a single base substitution could alter the reading frame, which could result in a physiological disorder?Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’How many possible open reading frames (frameswithout stop codons) exist that extend through the following sequence?5′... CTTACAGTTTATTGATACGGAGAAGG...3′3′... GAATGTCAAATAACTATGCCTCTTCC...5'In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter? (More than one may apply). A. Synthetic mRNA B. DNA C. Anti-codons D. Radioactive amino acids E. Large ribosomal subunits F. Small ribosomal subunits
- Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand. tRNA UAA CCA UUA UAA mRNA Amino Acids AUU = isoleucine AAU = asparginine GGU = glycine GUC = valine GAG = glutamic acidUsing the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -TerminationFor each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG