Nonallelic homologous recombination between repeats in the same orientation would not produce: Inversion Deletion Duplication Recombination
Q: Which of the following is considered to be a spontaneous source of mutations that impact the genome?…
A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…
Q: Used as markers for identification purposes, ___________ are locations on the chromosome that…
A: The size of the human genome is largely due to the presence of 3.2 billion base pairs in DNA. The…
Q: Nonallelic homologous recombination between repeats in the same orientation would not produce:…
A: Introduction :- There are two types Homologous Recombination :- allelic Homologous recombination (…
Q: hich repair mechanisms is most require to fix thymine dimers? BER NER mismatch repair…
A: When many proteins and RNAs are damaged, they will be degraded and sugars, are metabolized in order…
Q: Which of the following types of mutations would be produced by repair of a CRISPR-targeted double…
A: Non Homologous End joining is described as the pathway required for the repairing of those double…
Q: Which of the following is not a function of single-strand binding proteins? O prevents reformation…
A: SSBPs : Also called the single-strand binding proteins are a key component of the DNA replication…
Q: Entire sequence below needs to be amplified by PCR and subcloned into a plasmid vector. Which of the…
A: A plasmid vector is a type of DNA molecule that can be used to carry foreign genetic material into a…
Q: TBP is a eukaryotic DNA binding protein that specifically recognizes the Pribnow box. True False
A: Introduction: The TATA box binding protein provides instructions for making a protein called TATA…
Q: Which of the following could be used to repair a single nucleotide error in replication or a damaged…
A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…
Q: Nonallelic homologous recombination between repeats in the same orientation would not produce: O…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: Which of the following DNA repair systems could be used to repair the damage caused by UV light…
A: Due to the exposure to the UV rays, the structure of DNA gets distorted causing bends which leads to…
Q: In CRISPR genome editing technology, when the Cas9 protein cleaves the target DNA sequence, what…
A: The microorganism depends on multiple defense strategies that support them to resist viral attack.…
Q: Which of the following is an example of a balanced mutation
A:
Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…
A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…
Q: Which of the following process generates a new copy of the transposable element at a new location of…
A: Transposition is a DNA recombination reaction that results in the translocation of a discrete DNA…
Q: A F- recombinant is only made after conjugation of a ________ strain with a _______, while an ______…
A: The fertility factor also known as F plasmid refers to a sex factor that allows the transfer of…
Q: Which of the following molecules helps relieve the tension of unwinding parental DNA strands, by…
A: DNA replication is defined as a process by which a single DNA molecule will produce two identical…
Q: True or False: When transcribing the missense strand the direction of growth is towards the…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: An RNA-dependent DNA polymerase that carries the RNA template with it to synthesize repeats at the…
A: Replication is the process of duplication of the DNA. Replication is initiated by recognizing the…
Q: What kinds of DNA sequences are the "solution" the to C-Value Paradox? Transposable elements…
A: C-value indicates the amount of DNA present in the haploid cell or half of the DNA present in the…
Q: Which of the following process occurs between DNA molecules of very similar sequences?a) Homologous…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic material in the…
Q: Some chromatin remodeling factors use energy from ATP hydrolysis to slide nucleosomes.shifting…
A: Chromatin remodeling can significantly alter gene expression. It is studied under the domain of…
Q: Which of the following would be involved in the excision repair of a thymine dimer? O DNA polymerase…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: What the most likely cause of mutation CCC to CCG? Select an answer and submit. For keyboard…
A: Mutation as the process to change or cause a permanent change in the DNA of an organism. This can be…
Q: True or False. Chromatin remodeling is required for both homologous recombination and non-homologous…
A: In homologous chromosomes, exchange of the chromatin material occurs between the sister chromatids…
Q: DNA in an open configuration is common in the darkly staining regions called heterochromatin. True…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around…
Q: form a covalent linkage to both strands of the DNA helix at the same time, making a translent…
A: Replication: The process of replicating a double-stranded DNA molecule into two identical DNA…
Q: Label the following features as being part of either theta or rolling circle replication by dragging…
A: Two Forks is Theta One Fork is Rolling circle No termination is Theta Termination is rolling…
Q: Segregation refers to which of the following? homolog pairing O recombination ploidy reduction DNA…
A: Chromosome segregation or segregation of genes take place at Anaphase of meiosis. Chromatid…
Q: A transposable element or sequence of DNA that can move within the genome Group of answer choices…
A: Transposable elements or sequences of DNA that can move within the genome are also called jumping…
Q: The main difference between Type I and Type ll mobile genetic elements is that Type I spread via a :…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: What effect does the transposon have on the function of gene X in this figure?
A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…
Q: Define the following terms:a. histonesb. heterochromatinc. euchromatind. intergenic sequencese.…
A: Ans: The terms given in the questions are all related to the genome of an eukaryotic organisms, they…
Q: Select the CORRECT pairing. DNA polymerase I : links Okazaki fragments together DNA helicase :…
A: DNA polymerase is an enzyme used in the synthesis of new DNA strand in the 5'-3' direction.…
Q: Recombinational repair is often due toa) Incorporation of many incorrect nucleotides by DNA polb)…
A: The damage to deoxyribonucleic acid is a common occurrence in all cells. Most of this damage is…
Q: Fig. 1 shows a simple illustration how recombinant DNA are made. DNA sequence of interest DNA of…
A: The picture describes the process of making recombinant DNA. A recombinant DNA is a DNA molecule…
Q: Match the following Conjugation terms with the most appropriate description in the image: F-…
A: Introduction Conjugation Is The Transfer Of Genetic Material From One Bacterium To Another Through…
Q: A.) Homologous recombination repair are prone to error and can cause loss of genome integrity.…
A: DNA repair guarantees an organism' existence by allowing children to acquire parental DNA as…
Q: Which of the following process occurs in regions where no large –scale sequence similarity is…
A: Recombination is defined as process of breaking down of DNA and recombining into different allelic…
Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…
A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…
Q: Which of the following occurs between particular short sequences present on otherwise dissimilar…
A: The genetic recombination is the process of exchange of genetic material between two different…
Q: Which of the following is not a way in which genetic recombination occurs bacteria. Group of answer…
A: Prokaryotes are the single celled organisms (unicellular) and are the simplest form, which do not…
Q: The sequences of the recombination sites recognized by site-specific recombinases area) Partially…
A: Recombination is a process by which pieces of deoxyribonucleic acid (DNA) are broken and recombined…
Q: Repeated sequences can lead to many chromosomal rearrangements following of two repeats and (3…
A: Chromosomal rearrangements are alterations in the chromosome sequence which is majorly caused by…
Q: Which of the following DNA-synthesizing enzymes has 5’ to 3’ polymerization activity?
A:
Q: In the procedure for isolating DNA, what is the purpose of adding washing-up liquid? Washing up…
A: By disrupting the nonpolar connections that keep the cell membrane together, it allows the cell…
Q: An enzyme to add nucleotides specifically at the ends of chromosomes would be: Question 6 options:…
A: Chromosomes are the carrier of hereditary DNA molecules and have a thread-like appearance. They are…
Q: Chromosomal rearrangements can be caused crossing over between repetitive (duplicated) DNA segments…
A: Genetic variation ranges from a single nucleotide which is called single nucleotide polymorphism to…
Q: group of unstable DNA polymerases that produce short DNA sequences when the normal polymerase cannot…
A: Dna polymerase is an enzmye that helps the dna to replicate. This replication of dna occurs during…
Step by step
Solved in 2 steps
- In addition to correcting DNA mismatches, themismatch repair system functions to prevent homologousrecombination from taking place between similar but notidentical sequences. Why would recombination betweensimilar, but nonidentical sequences pose a problem forhuman cells?If you are comparing the two telomeres in each entryin the following list, in which cases would you expectthe two telomeres always to have exactly the samenumber of TTAGGG repeats?a. One telomere at one end of a chromosome, one telomere at one end of a nonhomologous chromosome.b. One telomere at one end of a chromosome, onetelomere at the corresponding end of the homologous chromosome.Define the following terms:a. histonesb. heterochromatinc. euchromatind. intergenic sequencese. tandem repeats
- If you are comparing the two telomeres in each entryin the following list, in which cases would you expectthe two telomeres always to have exactly the samenumber of TTAGGG repeats?a. One telomere at one end of a chromosome, one telomere at one end of a nonhomologous chromosome.b. One telomere at one end of a chromosome, onetelomere at the corresponding end of the homologous chromosome.c. One telomere at one end of a chromosome, theother telomere at the other end of the samechromosome.d. One telomere at one end of a chromatid, the othertelomere at the corresponding position in the sisterchromatid.What kind of chromosome rearrangement (shown as ?) is represented below? a. insertion b. Pericentric inversion c. Robersonian translocation d. Paracentric inversion e. balanced translocationWhich of the following is described as a structural rearrangement of a chromosome in which a broken piece has become reattached in the wrong location? Translocation Duplication Inversion Deletion
- Friedreich ataxia (FRDA) is an autosomal recessive, neurodegenerative disease that causes a lack of voluntary coordination of muscle movements. Affected individuals are homozygous for an unusually large number (expansion) of repeats of a trinucleotide sequence (GAA) in the first intron of the X25 gene. Unaffected individuals typically have between 7 and 38 repeats of the trinucleotide (GAAGAAGAAGAA…). FRDA patients have anywhere from 66 to over 1,700 repeats. To understand how the GAA trinucleotide expansion leads to FRDA, researchers looked at X25 gene expression by extracting RNA from affected and unaffected patients and doing a northern blot analysis (see the figure below): In panel “a,” the researchers used a probe to detect X25 mRNA. In panel “b,” the researchers used a probe on a duplicate of the original blot to detect human GAPDH mRNA (GAPDH is an enzyme involved in glycolysis). The sample labeled “YR” is mRNA from yeast cells that was used as a control. Explain…A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying its segments, that would result from the following mutations. Q. Pericentric inversion of BCDEA part of a sequenced chromosome has the sequence (on one strand)ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG. Which part of thissequence is most likely to take up the Z conformation?
- Explain how exon shuffling can be due to unequal homologous recombination.A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite transposond. retrotransposone. insertional element
