Fig. 1 shows a simple illustration how recombinant DNA are made. DNA sequence of interest DNA of interest Open vector Vector containing DNA of interest Vector DNA ligana joina the two DNA sequences together Rastriction enzymes cut out the DNA of interest and open the vector

Fig. 1 shows a simple illustration how recombinant DNA are made. DNA sequence of interest DNA of interest Open vector Vector containing DNA of interest Vector DNA ligana joina the two DNA sequences together Rastriction enzymes cut out the DNA of interest and open the vector

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Related questions

Q: How can DNA microarrays be used to determine which genes of a bacterial pathogen are expressed both…

A: DNA microarray or biochip is a technique wherein different DNA molecules are first attached to a…

Q: Which of the following ingredients does not belong in a sequencing reaction? (A ddNTPs B Primer C…

Q: Identify the correct sequence of steps involved in cutting and reassembling DNA molecules to make…

A: Answer: Recombinant DNA is the DNA which is made in the laboratory by combining two genetic…

Q: Why is this technique used?

A: All cells must synthesize some proteins for their cellular function. The instruction for protein…

Q: Put a primer on the top and bottom of bubble at origin. Identify 3’ ends. You can use a thicker line…

A: For DNA replication to occur, following steps take place -

Q: Below is a segment of DNA which you wish to amplify using PCR (polymerase chain reaction). The…

A: The DNA polymerase always bonds with the free 3'-OH of the primer and elongated the new DNA strand…

Q: In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are…

A: Indexing of genome is done in order to index all the small sequenes within the large genome.The…

Q: Recombinant DNA is: a. DNA that is produced when genes from one kind of organism are introduced by…

A: Genetic engineering is branch of science which deals development of recombinant DNA and making…

Q: The genomic DNA of a bacterial cell is not destroyed by the cell's own restriction enzymes because…

A: None of the above Restriction enzymes are the enzymes which cut DNA at a specific location called as…

Q: DNA polymerases make errors in matching as DNA is synthesized. These errors can be detected and…

A: DNA replication is the process by which two exact copies of DNA are made from an original DNA…

Q: Why are the first 20 bases typically ignored from a Sanger sequencing .ab1 file? The data quality is…

A: The data quality is too low and the data is noisy

Q: The enzyme of E.coli is a nuclease that initiates the repair of double stranded DNA breaks by…

A: unlike the Holliday module of homologous recombination, the double strand break repair [dsb repair]…

Q: You have 15 tubes, each containing 5 ul of DNA (each tube has a different DNA to cut). You want to…

A: A reaction mixture is a combination of 2 or more reactants in definite proportions to carry out a…

Q: Which of the following process generates a new copy of the transposable element at a new location of…

A: Transposition is a DNA recombination reaction that results in the translocation of a discrete DNA…

Q: DNA obtained from the indicated donor type recombinants are scored. The number of wild-types for…

A: Recipient lacking in b and c genes (a+ b-c-) has the largest number of transformed colonies(462

Q: A F- recombinant is only made after conjugation of a ________ strain with a _______, while an ______…

A: The fertility factor also known as F plasmid refers to a sex factor that allows the transfer of…

Q: Copying errors that slip by DNA polymerase proofreading can be corrected by DNA ligase. direct…

A: The major inheritable material is the Deoxyribonucleic Acid (DNA). The mechanism of copying…

Q: You are cloning a gene from a eukaryotic organism into a plasmid to produce a recombinant protein in…

A: The biological process by which naked DNA (deoxyribonucleic acid) gets transferred from one…

Q: You have a bacterium that is mutated in the lacZ gene. You transform this bacterium with a plasmid…

A: Introduction :- LacZ's gene product is -galactosidase, which breaks down lactose, a disaccharide,…

Q: Which of the following molecules helps relieve the tension of unwinding parental DNA strands, by…

A: DNA replication is defined as a process by which a single DNA molecule will produce two identical…

Q: Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to…

A: Answer: REPLICATION of DNA : It is the process in molecular biology where DNA strands are used to…

Q: During replication, proofreading is accomplished by _____ and removes the incorrect base __

A: Answer: DNA REPLICATION : It is the process in central dogma where DNA replicates itself resulting…

Q: DNA saquance of interest DNA of interest Open vector Vector containing DNA of interest -Vector DNA…

A: When a genetically changed vector is injected and integrated into the genome of an organism (host),…

Q: Which of the following will lead to DNA cutting more frequently? Choose all that apply.

A: The restriction enzymes are enzymes that cut the DNA at specific nucleotide sequences called the…

Q: You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding…

Q: The following diagram shows the two strands of a single DNA molecule, with a pair of PCR primers…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: Which of the following process occurs between DNA molecules of very similar sequences?a) Homologous…

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic material in the…

Q: The Southern blot procedure was developed so that: DNA fragments that have been subjected to…

A: Southern blotting is the technique for the detection of specific DNA fragments. The detailed…

Q: Which of the following contain only the sequences required for transposition and the genes for…

A: Transposons are the DNA sequence which can change their position within the genome. It may be simple…

Q: Which of the following ingredients precisely controls which small section of a very large DNA…

A: The acronym PCR stands for polymerase chain reaction. It's a test that looks for genetic material…

Q: Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation…

A: Agarose gel concentration More the concentration of the agarose gel more smaller will be its pores.…

Q: DNA in an open configuration is common in the darkly staining regions called heterochromatin. True…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around…

Q: A transposable element or sequence of DNA that can move within the genome Group of answer choices…

A: Transposable elements or sequences of DNA that can move within the genome are also called jumping…

Q: Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the…

A: DNA replication refers to an enzyme-mediated complex process that produces replicate or copies of…

Q: Select the CORRECT pairing. DNA polymerase I : links Okazaki fragments together DNA helicase :…

A: DNA polymerase is an enzyme used in the synthesis of new DNA strand in the 5'-3' direction.…

Q: 1. You make a recombinant plasmid vector that contains an insert of a gene you are interested in…

A: Gel electrophoresis separates the DNA on the basis of its size. The DNA is loaded on the well on the…

Q: A.) Homologous recombination repair are prone to error and can cause loss of genome integrity.…

A: DNA repair guarantees an organism' existence by allowing children to acquire parental DNA as…

Q: Which of the following occurs between particular short sequences present on otherwise dissimilar…

A: The genetic recombination is the process of exchange of genetic material between two different…

Q: fellow lab worker brings you DNA containing what might be a similar gene in Leopard Geckos (XG). She…

A: Polymerase chain reaction (PCR) involves amplification of a nucleotide sequence using respective…

Q: The sequences of the recombination sites recognized by site-specific recombinases area) Partially…

A: Recombination is a process by which pieces of deoxyribonucleic acid (DNA) are broken and recombined…

Q: Which of the following is not essential to carry out the polymerasechain reaction?a. primers b. DNA…

A: PCR is the polymerase chain reaction and is used to make various copies of a specific region of DNA…

Q: During the second step of PCR, the temperature is lowered in order to: denature the taq polymerase…

A: The term 'PCR' stands for Polymerase chain reaction wherein a single DNA fragment can be used as a…

Q: Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation…

A: Replication of DNA : DNA replication is the process where a new strand exactly similar to the…

Q: The following is an example of what type of mutation? Normal DNA: 5' - ATGACGTCA - 3' Mutated DNA:…

A: Thank you for the question Answer = The correct answer is option A (Deletion). Explanation :- This…

Q: single strand binding proteins are important for this activity prevent replication of the ends of…

A: Single strand binding protein (SSB) are a type of protein found in both viruses and microorganisms…

Q: What is chromosome walking?a) Hybridization techniqueb) Sequencing techniquec) Genetic markerd)…

A: Chromosome walking is a cloning technique that uses a genetic marker to probe a genomic library.…

Q: An enzyme to add nucleotides specifically at the ends of chromosomes would be: Question 6 options:…

A: Chromosomes are the carrier of hereditary DNA molecules and have a thread-like appearance. They are…

Q: If you need to make a lot up to 1 billion copies of a piece of DNA you would use 1. gel…

A: Polymerase chain reaction is the method of making millions of copies of a specific DNA. It was…

Q: Cas9 is a protein that cuts nucleic acids a delivery vector a small DNA binding…

A: Introduction CRISPR/Cas9 is a technology for modifying DNA in a genome, an organism's whole set of…

Question

Please explain this picture

Fig. 1 shows a simple illustration how recombinant DNA are made.
-S
DNA saquance
of interest
DNA of
interest
Open
vector
Vector containing
DNA of interest
Vector
DNA ligase joina the two
DNA sequences together
Rastriction enzymes cut
out the DNA of interest
and open the vactor

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Answer

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna
Recombinant DNA molecule is produced by ligatinga) Two DNA segmentsb) Two m-RNA moleculesc) One m-RNA with one t-RNAd) One m-RNA with DNA segment
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
A bacterium has a genome size of 4.4 Mb. If a researchercarries out shotgun DNA sequencing and sequences a totalof 19 Mb, what is the probability that a base will be leftunsequenced? What percentage of the total genome will beleft unsequenced?
why is recombinant DNA is possible becuase we know dna molecules from all organisms share the same chemical structure and differ only in the nucleotide seqeunce within the identical structure
In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging strand prior to the action ofDNA polymerase I. The lagging strand contains three Okazakifragments. The RNA primers, which are shown in red, have not yetbeen removed. A. Which Okazaki fragment was made first, the one on the left orthe one on the right?B. Which RNA primer will be the first one to be removed by DNApolymerase I, the primer on the left or the primer on the right?For this primer to be removed by DNA polymerase I and for thegap to be filled in, is it necessary for the Okazaki fragment inthe middle to have already been synthesized? Explain.C. Let’s consider how DNA ligase connects the left Okazaki fragmentwith the middle Okazaki fragment. After DNA polymerase Iremoves the middle RNA primer and fills in the gap with DNA,where does DNA ligase function? See the arrows on either sideof the middle RNA primer. Is ligase needed at the left arrow, atthe right arrow, or both?D. When…
The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true
If a restriction enzyme cuts between the G and the A whenever itencounters the sequence GAATTC, how many fragments will beproduced when the enzyme is digested with DNA with the followingsequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGCa. Two c. Fourb. Three d. Five
Which of the enzymes from the following list wouldyou need to make a recombinant DNA molecule? Whatis the function of those enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase
Which of the enzymes from the following list wouldyou need to sequence DNA? What is the function ofthose enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase
A segment of DNA has the following sequence:TTGGATGCTGAACCTACGACA. What would the sequence be immediately after reaction withnitrous acid? Let the letters H represent hypoxanthine and Urepresent uracil.B. Let’s suppose this DNA was reacted with nitrous acid. Thenitrous acid was then removed, and the DNA was replicated fortwo generations. What would be the sequences of the DNAproducts after the DNA had replicated two times? (Note:Hypoxanthinepairs with cytosine.) Your answer should containthe sequences of four double helices.
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork