Norelly. 16-27 How does chitin differ from cellulose in structure and func- tion? Biochemistry Name Problem Assignment C16C: Polysaccharides
Q: What is the purpose of inverting (or siding up) an inoculated plate when we place it inside…
A: The incubator is used for the incubation of Petri plates. Petri plates are used to grow the…
Q: When disaccharides are heated in the presence of a strong acid, the linkage joining the two…
A: There are four types of biological macromolecules, nucleic acids, proteins, carbohydrates and…
Q: How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate:…
A: Glycolysis is a process of breakdown of glucose to 2 molecules of pyruvate. This process also forms…
Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…
A: Lambda DNA is a linear DNA extracted from E coli bacteriophage with 485052 base pairs (bp) At each…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Most enzymes are proteins and proteins are primarily made up of amino acids. Amino acids bond with…
Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…
A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…
Q: Which amino acids are exclusively ketogenic? lysine leucine tyrosine isoleucine arginine
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Recall that vmax is achieved only at high substrate concentrations. Do you predict that vmax will…
A: Enzyme kinetics is the study of enzyme reactions rates and the conditions which affect them. Enzyme…
Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…
A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…
Q: Use the provided theoretical titration curve of histidine in answering the questions asked. Hd 14 12…
A: Histidine has 3 ionizable groups. The alpha-carboxylic acid group, the alpha-amino groups and the…
Q: To get all of the amino acids out of the oligopeptide below and into the bloodstream through the…
A: Oligopeptide: Any of the enzymes in the family of proteolytic enzymes, commonly known as proteases,…
Q: 7. what are the types of processing a eukaryotic mRNA is subject to, and how do they occur?
A: mRNA is called messenger RNA. mRNA act as a transcript for the synthesis of peptide or proteins.…
Q: Submit a drawing of the following phospholipid: -x-group is phosphoserine (use google if you need…
A: Glycerophospholipids or phospholipids are lipids found in the biological membrane. In phospholipids,…
Q: What compound of phosphorus is found in nucleic acids? What are the products of hydrolysis in RNA…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Chemical biologists view metabolism's citric acid cycle as its fulcrum. The enzyme isocitrate…
A: Citric acid cycle: (Krebs cycle) Citric acid, a tricarboxylic acid that is frequently referred to…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone released by the beta cells of the pancreas. The key function of insulin…
Q: The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Nonessential amino acids can be synthesized in the body in which the cells provide the carbon…
Q: explain what coupled transcription-translation is, and why it occurs in prokaryotes but not…
A: According to the central dogma of molecular biology, the process of gene expression involves two…
Q: Protein folding can be described as an equilbrium between an unfolded state (U) and the folded…
A: Change in Standard Gibbs free energy (∆G0') is the change in Gibbs free energy (∆G) at equilibrium.…
Q: 1. Discuss how the pH and temperature affect the solubility of protein. 2. Explain "salting-in" in…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: The first reaction in glycolysis is the phosphorylation of glucose to form glucose 6-phosphate: P: +…
A: Given Values: ∆G°=13.8 kJ/mol or 13800 J/mol[Pi] = 5 mM[Glucose] = 5 mM
Q: Provide the principle of each test used to detect the following substances. 17. RNA: 18.…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 4. You are to choose the members of an expedition that will climb several high mountains. Each…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: One of the hallmarks of competitive inhibition is that there is constant competition between the…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: In most enzymes, the required active site amino acids consists of only a few residues. Why is the…
A: Enzymes are proteins that function as biocatalysts and catalyse biochemical reactions.They have a…
Q: Questions Not yet answered Flag question Question 5 Not yet Flag question Complete the following…
A: Note: We are authorized to answer one question at a time. Since you have not mentioned which…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: . The book dived into allosteric enzymes and how they are regulated in metabolic pathways, but…
A: Michaelis Menten enzymes are those that follow MM kinetics. These enzymes have their reaction rates…
Q: 1. Enzymes A) tilt the reaction equilibrium in favor of product formation B) tilt the reaction…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes…
Q: Consider the each of the amino acids in the peptide below.…
A: Amino Acids: Although the liver is the primary location for amino acid metabolism, other organs…
Q: is lapoamide involved in oxidation reduction..
A: INTRODUCTION : First of all there is no such biochemical name like Lapoamide(its incorrect) The…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: The catabolism of carbohydrates, fatty acids, and amino acids generates the reducing equivalents…
Q: Incubation of the norsolinic acid synthase holo-ACP with malonyl CoA gave malonyl-S-ACP (molecular…
A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…
Q: CONNECT Explain why the proton gradient formed du chemiosmosis represents a state of low entropy.…
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Q: A patient weighing 38.4 pounds presents with a bacterial infection and is prescribed a course of…
A: A multitude of bacterial infections can be treated with the antibiotic amoxicillin. These include…
Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?
A: Bioreactors are vessels housing cell cultures , that provide optimum conditions for cell growth and…
Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…
A: Two dimensional (2D) polyacrylamide gel electrophoresis (2D PAGE) is a more powerful technique than…
Q: Galactose 1-phosphate + UDP-glucose → UDP-galactose + glucose 1-phosphate Which pairing correctly…
A: Glycolysis is the metabolic pathway through which one 6 carbon glucose is converted into two 3…
Q: Below is a fractional saturation curve for O2 binding to adult hemoglobin. Assume that curve Y…
A: Fractional saturation curve of Haemoglobin for oxygen binding describes the amount of oxygen that is…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…
Q: The PI of protein P is 7.3. One can purify protein P by:
A: The proteins are composed of twenty naturally occurring amino acids that are linked vis peptide…
Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…
A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…
Q: Hydrates Experiment: Cupric sulfate crystals were examined. Do you see any water in the crystals?
A: INTRODUCTION : Hydrates experiment - Most of the solid chemical compounds will contain some water if…
Q: 1. Oxidative phosphorylation and synthesis of ATP in mitochondria: • ways of ATP formation in cells…
A: Since you have asked multiple questions with multiple sub-parts, we will solve the first three…
Q: COPII-coated vesicles bud out of the TGN to transport proteins to the lysosomes. True False
A: COP II coat proteins direct protein and membrane trafficking in between early compartments of the…
Q: Mach column (A) with Column (B)?* Waxes Serous gland Sphingolipids Fatty acid Beta oxidation Ketone…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: If your body sense that is very low on the substrates necessary to produce ATP homeostatic control…
A: Deamination of amino acids - it is the process of breakdown of amino acids which occurs in excess…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP site is Apurinic site or Abase site at which nitrogen base is lost from the nucleotide of DNA and…
Q: Identify the enzyme involved in this reaction from the Krebs cycle. COO CH₂ CH₂ Coo FAD O isocitrate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 4 images
- It has long been recognized that breast milk protects infantsfrom infectious diseases, especially those that affect the digestive tract. The main reason for this protection appears tobe a large group of oligosaccharides that are components ofhuman milk. Suggest a rationale for the protective effect ofthese oligosaccharides.will UPVOTE Answer the questions. 1. Inulin is a polysaccharide composed of entirely fructose units. Which test should be used to best identify the presence of fructose? Why? 2. Which test can you use to distinguish a monosaccharide from a disaccharide? Hexoses from Pentoses? How?What type of carbohydrate is this? Osazone Test Result: Starfish-like structure with distinct bell-shaped features and spikes. Melting point determination resulted in 195 degrees celcius.
- HYDROLOSIS OF CARBOHYDRATES "Comple the table below" You can use this video as your references : https://youtu.be/uWIEBKKsaTspart 1What is the % w/v of a 250ml solution containing 120mg of sucrose? part 2What is the % v/v of a 100 ml solution containing 3ml of ethanol?35. Identify what is being describe in each statement Most common carbohydrates
- Why doesn’t the starch leave the cellulose bag and move into the beakersolution?What are the Carbohydatre's Classification (tabulate: classification,function, structure, example, sources) a. Monosaccharides: Glucose,galactose, fructose b. Dissacharides: sucrose, lactose, maltose c. Polysaccharides: starch, glycogen, cellulose, chitinVideo resource: Biochemistry of carbohydrates by Armando Hasudungan