7. what are the types of processing a eukaryotic mRNA is subject to, and how do they occur?

Q: Which of the following is correctly classified? O Arachidic (20:0) is a medium chain unsaturated…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…

Q: When disaccharides are heated in the presence of a strong acid, the linkage joining the two…

A: There are four types of biological macromolecules, nucleic acids, proteins, carbohydrates and…

Q: 3. Given the following peptide sequence, GSICDNCR, the estimated net charge at the given pH is: a)…

A: Peptides: Organic substances known as amino acids include both amino and carboxylic acid functional…

Q: What is the hydrogen deficiency index and calculate it for cholesterol

A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…

Q: Concerning the citric acid cycle (TCA cycle), which of the following statements is false? The TCA…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…

Q: Question 12 of 25 Which of the following are characteristics of animal cells? Select the correct…

A: The somatic cell in animals undergo division by the process of mitosis.  The cellular microtubular…

Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…

A: Reductant is a substance that donates electrons to another substance and reduce it. In an…

Q: Given the following reaction and equation for the initial velocity of the reaction: k₁ k3 E+SES E +…

A: We are given two equations for initial velocity (V). V=kcat [ES]    -------(eq1)       andV=k3 [ES]…

Q: If there is ample oxygen available, how many ATP can be produced from complete oxidation of glucose…

A: The aerobic breakdown of nutrients into carbon dioxide, water, and energy occurs during aerobic…

Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…

A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…

Q: Hydrates Experiment: Cupric sulfate crystals were examined. Do you see any water in the crystals?

A: INTRODUCTION : Hydrates experiment - Most of the solid chemical compounds will contain some water if…

Q: What explains the 10,000 to 1 selectivity of the potassium channel for K+ over Na+ considering that…

A: Channels are membrane proteins that allow biomolecules or ions to pass through them. Ion selective…

Q: What are the 3 steps of amino acid degradation:

A: Amino acids are biomolecules that act as the building blocks of proteins. Biologically important…

Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and…

A: An oxidizing species is the substance that donates electrons, and a reducing species is the…

Q: Lipids Function in Cell Signaling Q5.2: The lipids 7-dehydrocholesterol and arachidonate are…

A: Cell signalling is the process in which the cell responds to certain molecules called signalling…

Q: Consider the enzyme, ATCase. All are true except: It's K effectors are ATP and CTP It is a K…

A: ATCase (Aspartate carbamoyltransferase) is an enzyme which catalyzes the first step of the synthesis…

Q: Among the given statements, which are characteristics of plant cells? Select the correct…

A: Plant cell has Cell wall as the outermost layer. Cell wall being the outermost layer surrounds the…

Q: Why can plant material be substituted? Plants contain high amounts of saturated fats. Certain plants…

A: Introduction : Linoleate - A linoleate is a salt or ester of linoleic acid(which is an organic…

Q: Provide 3 most applications/purposes of DNA analysis.

A: Recall that: DNA is the genetic material passed down from one generation to another, ie, the…

Q: The following are true of the mitochondrial structure I. The inner mitochondrial membrane is…

A: Mitochondria are power house of cell, known to synthesize ATP. They are membrane bound organelles…

Q: H K Br Br H trans-2,3-dibromo-2-butene cis-1,2-dibromoethene Otrans-1,2-dibromoethene…

A: The structure given the question represents-  Answer- trans - 1,2- dibromoethene

Q: A geneticist is trying to determine how many genes are found in a 300,000 bp region of DNA. Analysis…

A: The question mentions that the geneticist is trying to figure out the number of genes that could be…

Q: 018 You have isolated a gene that spans a total of 1800 nucleotides. The gene contains 400…

A: Genes are the sequences of nucleotides attached together through phosphodiester bonds. Genes are…

Q: What effect does a negative effector have on the graph of reac- tion rate (V) vs. [substrate] for an…

A: INTRODUCTION : Allosteric enzymes : Allosteric enzymes are those enzymes which have an additional…

Q: The AG of the reaction C6H12O6 +602 --> 6CO2 + 6H₂O is -686 kcal/mol glucose The oxidation of…

A: For biological systems, free energy (G), enthalpy (H) and entropy (S) are related as : ∆G = ∆H - T∆S…

Q: How is aquaporin synthesised? List step by step. How is this protein made and targeted to its final…

A: Aquaporins (AQP) are protein channels that function in the transfer of water at very high rates…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: E mitochondria Question #: 25 While developing new inhibitors we came up with new compound, a…

A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…

Q: (pmol) (a-32P) GMP INCORPORATED N 111 (a) (b) (c) 20 5 (min) 2.6 10 The image above shows an…

A: In eukaryotes the RNA Polymerase II is involved in the synthesis of mRNA. The RNA polymerase and…

Q: Triose phosphate isomerase In a key reaction of glycolysis, dihydroxyacetone phosphate (DHAP) is…

A: Given Values: ∆G°=7.5 kJ/mol or 7500 J/molT = 37°C or 310 KR = 8.314

Q: For each of the structures listed below identify the class of lipids to which it belongs (fatty acid…

A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…

Q: What is the function of the alcohol in the extraction of DNA? What is the property/characteristics…

A: DNA extraction involves different steps which include, the breaking of cells to open and…

Q: What is the role of ribose in Central Dogma of Molecular Biology?

A: The information stored in the DNA flows to RNA and is then used in the synthesis of proteins. This…

Q: 1. State if true or false a. GLUT5 transporter carries fructose from the intestinal lumen into the…

A: GLUT5 Transporter : GLUT5 is a fructose transporter found & expressed on the apical border of…

Q: 16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released by…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…

Q: Discuss the role (direct or indirect) of carbohydrates on cancer and Suggest an appropriate…

A: Carbohydrates, lipids, and proteins are the biomolecules that are required in large amounts by the…

Q: The activity of an enzyme can be regulated by a: A) competitive inhibitor binding to the active…

A: The enzymes increase the rate of biochemical reactions and can be regulated by binding to…

Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…

A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…

Q: What is the isoelectric point of the peptide LIKES? Show your work below.

A: This peptide is composed of leucine, isoleucine, lysine, glutamic acid, and serine. This peptide…

Q: Select the correct response:

A: Tyrosine gives rise to catecholamines which includes dopamine, norepinephrine, and epinephrine.

Q: 12. The graph shows values of arterial plasma bicarbonate concentration and pH for different persons…

A: Metabolic alkalosis is caused by acid base imbalance in the blood. It is characterised by increase…

Q: RNA polymerase is found in the mitochondrial matrix.  True  False

A: The "powerhouses" of the cell are frequently referred to as mitochondria. They assist in converting…

Q: Draw a table that shows the monomer component and an example for each macromolecule

A: The four classes of biological macromolecules are nucleic acids, proteins, carbohydrates and lipids.…

Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…

A: Lambda DNA is a linear DNA extracted from E coli bacteriophage with 485052 base pairs (bp) At each…

Q: What are the roles of the other enzymes involved in replication and why they're necessary ?

A: Before cells divide, DNA replication must occur. DNA replication is the complete, faithful copying…

Q: What biomolecules have alcohol functional group in them? Give an example of a specific biomolecule…

A: Biomolecules possess different functional groups such as alcohol group, amino group, carboxyl group,…

Q: what element is this? after MDA reacts with something Ph CH3 N CH3

A: MDA is malondialdehyde . It is a product of lipid peroxidation in corals. Determination of this MDA…

Q: Imagine a disease that involves reduced expression of receptor X. There is no concentration of full…

A: In receptor-ligand interaction, the receptor is a macromolecule that serves as the binding site of…

Q: Only 0.1% of peptide bonds have the cis configuration. Calculate the difference in energy between a…

A: A peptide bond is formed between the alpha carboxyl group of the amino acid residue at the N…

Q: Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…

A: Introduction DNA acts as a genetic material in our body. DNA is a double stranded molecule. It is a…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.