can u help with q. 3? Thank you Now we will move on to module 3, where we will examine autoradiographs produced from Sanger sequencingthe p53 gene from tissue samples from Valerie's children.Determine the sequences based on the following simulated autoradiographs:A C G т1. Wild-type:B. What is the sequence of this portion of the wild-type p53 gene?TA CGT|2. Justin:=C. What is the sequence for this portion of Justin's p53 gene?3.IA C GTSheila:=D. What is the sequence of this portion of Sheila's p53 gene?E. Do Justin or Sheila have a mutation in the p53 gene?

The term DNA sequencing in compasses method for determining the order of the nucleotide bases,…

Now we will move on to module 3, where we will examine autoradiographs produced from Sanger sequencing the p53 gene from tissue samples from Valerie's children. Determine the sequences based on the following simulated autoradiographs: A I || 1. Wild-type: GT 11 I B. What the sequence of this portion of the wild-type p53 gene? || 3. Sheila: D. What is the sequence of this portion of Sheila's p53 gene? E. Do Justin or Sheila have a mutation in the p53 gene?

Now we will move on to module 3, where we will examine autoradiographs produced from Sanger sequencing the p53 gene from tissue samples from Valerie's children. Determine the sequences based on the following simulated autoradiographs: A I || 1. Wild-type: GT 11 I B. What the sequence of this portion of the wild-type p53 gene? || 3. Sheila: D. What is the sequence of this portion of Sheila's p53 gene? E. Do Justin or Sheila have a mutation in the p53 gene?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter12: Genes And Cancer

Section: Chapter Questions

Problem 13QP: The search for the BRCA1 breast cancer gene discussed in this chapter was widely publicized in the...

See similar textbooks

Similar questions

Can you please help me by drawing a serie of schematic figures that demonstrates the information in the paragraph below? In addition to phosphorylation, the C-terminal domain of p53 can also be acetylated and sumolated in response to DNA damage. Acetylation and sumolation both result in an increase in the transactivation ability of p53 and may account for this finding. In vivo, IR induces the acetylation of p53 at Lys320 by PCAF and Lys382 by CBP/p300. Acetylation at these sites is dependent on N-terminal phosphorylation at Ser15 and to a lesser extent on phosphorylation at Ser6, Ser9, and Thr18 (Saito et al., 2002; Wahl and Carr, 2001). All of these phosphorylation events are ATM-dependent, although only Ser15 has been shown to be phosphorylated directly by ATM. Sumolation occurs at Lys386 after DNA damage (Muller et al., 2000). Sumolation refers to the covalent attachment of a small ubiquitin-like molecule (SUMO-1) to Lys residues, but in contrast to ubiquitination, does not result…
"Changes to the p53 protein structure can be caused by differences in DNA and can affect protein function." Can you give detailed explanation why this is causation and not correlation? The explanation should be related with mutation, structure changes during protein synthesis, chemical property changes in amino acids, and functions of p53 protein.
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
As the most junior member of a lab, you are tasked with generating cell lines that accumulate DNA damage to investigate how random mutations affect transformation of cells into cancer cells. You decide to mutate proteins in the p53 pathway. Which three proteins would you mutate? Explain your reasoning.
Why is the p53 R273W mutation preventing p53 from binding to DNA?
2. a. You want to create a genetic construct that will express GFP in Drosophila. In addition to the GFPcoding sequence, what DNA element(s) must youinclude in order to express this protein in flies if theconstruct were integrated into the Drosophila genome? Where should such DNA element(s) be located? How would you ensure that GFP is expressedonly in certain tissues of the fly, such as the wing?b. Suppose you insert the GFP coding region plus allof the DNA elements required by the answer to part(a)—except the enhancer—between inverted repeatsfound at the ends of a particular transposable element.Because all of the DNA sequences located betweenthese inverted repeats can move from place to placein the Drosophila genome, you can generate manydifferent fly strains, each with the construct integrated at a different genomic location. You now examine animals from each strain for GFPfluorescence. Animals from different strains showdifferent patterns: some glow green in the eyes,others in…
A gene, which we will call gene C, can be epigenetically modified in such a way that its expression in some cells is permanently silenced. Describe how you could conduct cell-fusion experiments to determine if a cis- or a trans-epigenetic mechanism is responsible for maintaining the silencing of gene C.
You’re reviewing a manuscript in which the researcher claims that Gene A is more highly expressed than Gene B. The researcher supports their conclusion by noting the higher FPKM values for Gene A. Do you agree? Why or why not?
Mutations in the CFTR gene result in cystic fibrosis in humans, a conditions in which abnormal secretions are present in the lungs, pancreas, and sweat glands. The gene was mapped to a 500-kb region on chromosome 7 containing 3 candidate genes. a)Using your knowledge of the disease symptoms, how would you distinguish between the candidate genes to decide which is most likely to encode the CFTR gene? b)How would you prove that your chosen candidate is the CFTR gene?
If p63 can bind to the same promoter elements as p53, why would it be considered an inhibitor of p53? Can you clarify this relationship a bit?
For the P53, create a one page brief about the gene from genomics perspective.(just 250 word)
Scientists carried out a microarray analysis to compare the gene expression of normal pancreatic cells to that of cancer cells from a person with pancreatic cancer. The scientists labeled the cDNA from the normal pancreatic cells with green fluorescent nucleotides. They labeled the cDNA from the cancer cells with red fluorescent nucleotides. The two cDNAs were mixed and allowed to hybridize to a microarray. Less p53 activity is found in cancer pancreatic cells than normal cells. What color would the spot for the p53 gene be on the microarray? Red Green Yellow Black