Answered: observation fungi often grow on…

Science

Biology

observation fungi often grow on leftover food observation fungi such as mold and yeast grow more on leftover bread

Biomedical Instrumentation Systems

1st Edition

ISBN:9781133478294

Author:Chatterjee

Publisher:Chatterjee

Chapter16: Fiber Optics And Lasers In Bioinstrumentation

Section: Chapter Questions

Problem 10Q

See similar textbooks

Related questions

Q: Gloc Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia…

A: Introduction: Glochidia are the larval stage of freshwater mussels, including Quadrula mussels. The…

Q: (5)Baldness is an X-recessive linked trait. Baldness is epistatic to curly hair" which is dominant…

A: Baldness is X-linked and recessive, which means that any male with an X chromosome with a baldness…

Q: Suppose that allele D produces tiny ears and allele d produces normal ears. A heterozygous male with…

A: Introduction Penetrance in genetics refers to the percentage of individuals with a specific…

Q: Who invented/proposed the use of Punnett square in studying genetics? Give a short description of…

A: Gregor Johannes Mendel was an Austrian monk out Brun Monastery , who studied at Vienna University.…

Q: There may be more than one correct answer The ability of DNA to denature is important for which of…

A: DNA has double stranded structure.The process of breaking down double stranded DNA into single…

Q: Speculate about the following details of mitosis. 1. Why do chromosomes need to condense during…

A: MITOSIS The cell duplication is known as mitosis, one cell divides into two genetically identical…

Q: V V V V Ecosystem service: Provisioning Ecosystem function: Flow of information Ecosystem function:…

A: Introduction An ecosystem deals with biotic and abiotic factors and their interaction with each…

Q: You will read six articles from databases and assemble an outline, which will be posted in the…

A: Introduction: An artificial womb is a technology used for the growth and development of a fetus…

Q: 11. Why is the control of gene expression so critical for all living organisms? To conserve energy…

A: 11) Why is the control of gene expression so critical for all living organisms? Ans ) all the above…

Q: 8. Which statement/s about RNA is/are true? (Select all that apply.) * RNA is made through the…

A: 8.RNA stands for ribonucleic acid.It act as a genetic material in a viruses.It also play essential…

Q: 2) Deforestation has a crucial impact on the amount of carbon dioxide in the atmosphere. Which…

A: Deforestation has a drastic effect on the amount of carbon dioxide in the atmosphere. Carbon dioxide…

Q: Which amino acid will stop closest to the positive terminal in an anode?

A: Amino acids have a tendency to exist as Zwitter ions. A zwitter ion carries both positive and…

Q: Explain the different parts to the mitochondria

A: Introduction : Mitochondria is a double-membrane-bound cell organelle. It plays an important role…

Q: The inheritance of Huntington Disease can be explained by the concept of haplosufficiency. Select an…

A: Introduction Huntington Disease is a neurodegenerative genetic disorder that causes progressive…

Q: Would the biologist agree or disagree with the following statements? a) Since there was no…

A: Introduction :- Habitat refers to the place or type of environment where an organism lives and…

Q: Is there any linkage between aspergillosis and perirectal abscess that his brother had? Does this…

A: Perirectal abscess is collection of pus adjacent to the anus due to bacterial infection. Generally…

Q: An individual with genotype Dd Ee Ff will produce (——- )? different types of gametes. If an Ss Rr…

A: Introduction :- Gametes are specialized cells that are produced during sexual reproduction and are…

Q: 4b) The primary sweetener in Hershey’s special dark zero sugar us ___________________

A: Sweeteners are low-energy compounds that have a sweet flavour but lack the calories or the…

Q: metaphase II anaphase II B Phase C Phase E sister chromatids align at the center of the cell since…

A: Introduction:- Cell cycle is defined as the series of sequential regulated events that involves cell…

Q: What are the mechanisms in which DNA genomes evolve? Discuss two or more and provide examples and…

A: The term "genome evolution" refers to the process by which genetic material changes over time via…

Q: How is it possible Jonathan has the dominant disorder, Huntington’s Disease, if none of his family…

A: Huntington's disease is a medical condition during which nerve cells start to degenerate over time.…

Q: Match the part of a cell from the left column to the best description on the right. Golgi Apparatus…

A: Introduction Cell organelles are tiny structures within a cell that have specific functions to help…

Q: You have a pea plant with a yellow pea phenotype but do not know if the genotype is homozygous (YY)…

A: The yellow and green alleles, respectively, are designated by the alleles ‘Y’ and ‘y’. ‘Y’ is…

Q: 14. Assume you have the following stock solutions: 1 M Tris-HCl (pH 8.0) 0.5 M EDTA (pH 8.0) Perform…

A: Q.Ans:- Explanation:- Given that there is a need to form 30 ml of TE buffer. TE buffer is a solution…

Q: Tumor suppressor genes O become oncogenes when a "gain-of-function" mutation occurs O are classified…

A: Introduction:- The growth and development of organisms takes place by cell growth & cell…

Q: which scientists discovered that DNA is the "transformation factor"? Darwin and Lamarck Watson and…

A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around one another to form a…

Q: A researcher would like to determine how much influence genes have on the development of traits.…

A: A genetic research is a kind of study of the genes and its function which helps to determine certain…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of DNA, it is known as transcription. Transcription is…

Q: In the early stages the embryos are progresses the embryos ✓each other. As time so the late embryos…

A: A zygote is a diploid structure formed by the fusion and fertilization of gametes from both parents…

Q: 1. Types of DNA damage and their causes.

A: DNA is the nucleic acid present in the cells of the living beings. It is composed of…

Q: Considering that Noor and Hamza do produce a first child and name her Roop, what is the likelihood…

A: PKU (Phenylketonuria) is an inherited disorder caused by a lack of the enzyme phenylalanine…

Q: What is the function of a promoter in gene expression?

A: Transcription is the process through which ribonucleic acid (RNA) is synthesised from DNA. The term…

Q: Design and describe an experiment using celery stalks to demonstrate how certain conditions will…

A: A hypothesis is an assumption formed based on evidence. This is the first step in any investigation…

Q: A- B C D E- Prokaryotic Cell Structure -F 4041 -G -H Match the prokaryotic cell structure to the…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: answer the 3 parts

A: A phylogenetic tree represents the evolutionary relationship between organisms and their ancestors…

Q: Describe the levels of organisation within the human body

A: The cell is the first level of organisation in the human body. Organs are formed from tissues, which…

Q: Many biochemical reactions are non-spontaneous but are required for living organisms. How can they…

A: Chemical processes known as "biochemical reactions" happen within the cells of living beings. The…

Q: Auricular hypertrichosis is a dominant Y-linked condition. Select an answer and submit. For keyboard…

A: Excessive hair growth in specific areas of the body is called hypertrichosis. It is commonly seen in…

Q: Which one of the following is NOT a characteristic of prokaryotic cells? Cytoplasm.…

A: INTRODUCTION The oldest single-celled microbes on Earth are prokaryotic cells. Bacteria and archaea…

Q: how did you get 104 as the dilution factor? I got 10-2 as the dilution factor for the CNFL plate

A: The CFU stands for the colony forming units. The formula for calculating the CFU/ml is as follows:…

Q: A cell was isolated from a crime scene. Observations revelated the cell has ribosomes, its DNA is…

A: Prokaryotes and eukaryotes are the two main types of cells found in living organisms. Prokaryotic…

Q: The relationship between SES and health can be described as: Biological difference Measure of…

A: People with lower socioeconomic status (SES) have higher morbidity and mortality rates than those…

Q: Imagine three islands, each with a population of frogs. There are approximately 1,100 frogs on…

A: Introduction A population is a group of living organisms of the same species that live in the same…

Q: After a meal that contains carbohydrates, blood glucose levels usually rise gradually as…

A: Introduction : Carbohydrates are a large group of naturally occurring organic compounds that are…

Q: Could you please explain these: 1. Why analyze the unknowns in a (short) serial dilution rather…

A: Introduction: DNA concentration refers to the amount of DNA present in a sample. It is typically…

Q: This diagram shows two homologous chromosome pairs from a mouse after DNA replication. Chromosomes…

A: Cell cycle is series of events. It is responsible for dividing the parents and into daughter cells.…

Q: Out of mackies of scotland honey comb milk chocolate with honey comb pieces, hersheys special dark…

A: The nutritive value of a food refers to the amount of essential nutrients it provides, such as…

Q: A 16-square Punnett is time-consuming to draw out. Dr. Thompson can easily solve this problem by…

A: A Punnett square is a graphical representation used in genetics to predict the probability of an…

Concept explainers

Fungi

Fungi can be single-celled or complex multicellular creatures. They are found in pretty much any natural surroundings; however, they generally live on the land, principally in soil or plant material instead of in the ocean or water. Fungi are the members of the group called the decomposers that live off dead and decaying matters. Fungi assume a significant part in the carbon cycle and its different components. They act as a parasite by causing illnesses like rusts, scabs, or ulcers. In crops, contagious illnesses can prompt critical money-related misfortune for the rancher. An exceptionally modest number of growths cause illnesses in creatures. In people, these incorporate skin illnesses such as competitors' feet, ringworm, and thrush.

Question

observation fungi often grow on leftover food observation fungi such as mold and yeast grow more on leftover bread

Definition Definition Diverse group of organisms that primarily obtain nutrients through absorption. They range from single-celled yeasts to complex multi-cellular structures such as mushrooms. Fungi play important roles in ecosystems as decomposers, plant symbionts, and even pathogens. They also have practical uses in medicine, food production, and industry.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction:

VIEW

Science Behind Fungal Growth on Leftover Bread:

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Plants are a source of food fuel medicine all of the above
Organisms that can make their own food using inorganic molecules are called: autotrophs heterotrophs photoautotrophs chemoautotrophs
The yeasts whose fermentation reactions produce the carbon dioxide that makes bread rise are a type of _____. a. chytrid b. zygote fungus c. sac fungus d. club fungus
Instructions: Create a concept mapping in the Historical Development of Microbiology and write a brief explanation about it. DO NOT COPY CONCEPT MAP ON THE INTERNET I WILL GIVE BAD FEEDBACK asap
Microbes which feed on dead organic material are classified as: pathogens parasites saprophytes autotrophs
WHY IS IT IMPORTANT TO HAVE PEST CONTROL MANAGEMENT?
Name the bacterias and good benefits to humans. Good Bacteria Benefits 1. 2 3 4 5 6 7 8 9 10
This is microbiology question. I got it wrong. Choose right one and give reason why it’s right and why others are wrong
Jeff prepared a tissue culture medium containing macronutrients, micronutirnts and vitamins. He adjusted the pH of the medium to 8 and agar was added into the medium. The medium was autoclaved at 121℃ and 15 psi for 30 minutes. Comment the medium that Jeff prepared for inducing shoot formation
Draw the common pest damage/sign of the pest given and supply the information asked. You can use colors or crayons in your illustrations to emphasize symptoms/damage. Disease: Mango Anthracnose Pest (Common name and Scientific Name): _________________________________________ Other crop affected by Anthracnose other than mango: _________________________________ Description of damage: ________________________________________
Mang Isko has one hectare corn production with high-value vegetable near in it. He wanted to apply herbicide in his weed-infested corn through spraying. Is his decision effective? What do you suggest pest control? Give at least 4 sentences.
An extreme-weather event has knocked out power in your community. Even with rebuilding efforts, it appears that it could be 6 months or longer before power is restored. Since you have a background in microbiology, the people you know are asking you for possible ways of storing/preserving their food safely without electricity. What advice can you give them, and why would you make those recommendations?