3b. An additional gene, called W, is found that affects the synthesis of enzymes 1 and 2. Mutantd has a recessive mutation in gene W.genotypeenzyme activitywithout fictamine1with fictamine2strainWXYZ21wild-type +++++++mutant a+++mutant bmutant c+++mutant d+++++Once again, justify each answer in one sentence.i) Is gene W most likely a positive or a negative regulator?ii) Is the activity of W activated or inactivated by the presence of fictamine?+!++1¦::#111;¦++:++++

A bacterium can produce fictamine, an imaginary amino acid. Initially, mutagenesis revealed three…

Answered: Once again, justify each answer in one…

Once again, justify each answer in one sentence. i) Is gene W most likely a positive or a negative regulator? ii) Is the activity of W activated or inactivated by the presence of fictamine?

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 4CT: The photos below show flowers from two Arabidopsis plants. The plant on the left is wild-type...

See similar textbooks

Related questions

Q: What is a typical value for an inhibitory post synaptic potential? Why is it inhibitory?

A: An inhibitory post synaptic potential is a kind of synaptic potential that makes a postsynaptic…

Q: In which of the following phases does this specific arrangement of chromosomes occur? No answer O…

A: 25) The given arrangements of the chromosome shows the stage in which the genetic material of the…

Q: a. Southern blot b. Northern blot c. methylation analysis d. two of the above e. all of the above

A: Genetic diseases are the diseases in evict there is either mutation in the DNA itself is if there…

Q: What does the size and shape of teeth say about the diets of each primate?

A: Dental arcade The curve of the shape of teeth is termed a dental arcade. Four types of teeth make up…

Q: What is the function of aerobic compost bins and what are its benefits? Elaborate.

A: Introduction Composting:- It is the recycling of organic wastes, such as vegetable peels, waste…

Q: Use a simple diagram to explain how presynaptic inhibition works.

A: Presynaptic restraint is delivered by expanding Cl(- ) conductance, bringing about an activity…

Q: a. Southern blot b. Northern blot c. methylation analysis d. two of the above e. all of the above

A: Genetic diseases are the diseases in evict there is either mutation in the DNA itself is if there…

Q: A 32-year-old woman comes to the office with her 2-year-old son, whom you have been treating for…

A: Spina bifida Spina Bifida is a defect in embryological development where the spinal cord is not…

Q: Describe 3 additional ways you theoretically would be able to increase the levels/yield of fruit…

A: ANSWER:

Q: Are mutations equally likely to occur in all locations in the genome? Why or why not?

A: Introduction Mutation: The changes that occur in DNA sequence or helical structure due to mutagens.…

Q: Choose the right combination of components required to set up a polymerase chain reaction from the…

A: Polymerase chain reaction is a method widely used to rapidly make millions to billions of copies of…

Q: Which describes an enzymatic activity/biochemical function of importin-beta? facilitate release of…

A: Introduction : Importin beta are known as a type of karyopherin proteins which mediates the…

Q: Did the results of this experiment agree or disagree with your original hypothesis Explain your…

A: I agree with the result of this experiment. In the photosynthesis process, maximum absorbing light…

Q: Each tRNA has unique identity elements recognized by its specific enzyme involved in charging it…

A: In this question we have to describe about the enzyme that is involved in transfer of amino acid on…

Q: Consider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase…

A: Introduction The lactose operon (also known as the lac operon) is a group of genes present in E.…

Q: When antibiotics and vaccination techniques were first discovered, the statement was made that all…

A: Vaccine can be defined as a non virulent preparation from the antigenic material ,which is able to…

Q: What is a typical value for an inhibitory post synaptic potential? Why is it inhibitory?

A: An inhibitory post synaptic potential is a kind of synaptic potential that makes a postsynaptic…

Q: Explain how mismatch repair fixes incorrectly matched base pairs.

A: During DNA synthesis, most DNA polymerases use a process is called proofreading to double-check…

Q: How many oxaloacetate molecules will be regenerated after the complete oxidation of 36 glucose…

A: Cellular respiration is a metabolic pathway in which glucose molecule is degraded and results in…

Q: What are the factors that must be considered in formulating diets for farm animals? Briefly explain…

A: Diet planning is an integral aspect of any daily feeding strategy. It is a method of accomplishing…

Q: How a fish that migrate from freshwater to seawater (and/or vice versa) osmoregulate?

A: Introduction Osmoregulation is a process by which an organism maintain a internal balance between…

Q: a. What type of nucleic acid and from what species would the scientist use to begin construction of…

A: Drosophila Cryptochrome -- Drosophila Cryptochrome is a blue - light sensitive protein which…

Q: Write a paragraph explaining either hemodialysis or peritoneal dialysis. You must use the following…

A: INTRODUCTION In hemodialysis the entire blood from your body is filtered by a machine which is…

Q: Use a simple diagram to explain how presynaptic inhibition works.

A: Presynaptic restraint is delivered by expanding Cl(- ) conductance, bringing about an activity…

Q: D. What are STICHIOCYTES? What are its uses?

A: Stichiocytes are the fragmented part of the red blood cells . These are irregularly shaped , jagged…

Q: How do we know that there are vesicles filled with neurotransmitters at the neuromuscular junction?…

A: The chemical messengers of the body are typically referred to as neurotransmitters. They are the…

Q: Epiphytes: Epiphytes have adapted to grow without soil in the canopy layer in a tropical rainforest.…

A: Epiphytes are also known as "air plants" because they are not held on to the forest floor. They grow…

Q: Which of the following is not an example of a protein with a quaternary structure? Haemoglobin in…

A: Proteins are the polymer of amino acids. These amino acids are joined by peptide bonds.

Q: Can you provide more

A: Aerated composting Composting is defined as a process in which the dead organic matter is converted…

Q: 4) Identify three positions of the patient to obtain a BP. 7) What problems can result from high…

A: Only three subparts can be answered per question as per Bartleby's policy and hence: - (i) Can…

Q: Imperfect Voluntariness happens when the person acts without fully realizing what he means to do, or…

A: A person's mental health is defined as their opportunity to understand, experience, communicate, and…

Q: The genetic code is said to be degenerate. This means that... A the code is universal used by…

A: The genetic code is a triplet code called a codon.

Q: Genetic resources Climate regulation Seed dispersal Aquaculture Recreation and ecotourism Air and…

A: Genetic resources - provisioning service Climate regulation - regulating service Seed dispersal -…

Q: E B a. Draw the structure of the acentromeric chromosome using a line and letters to designate loci…

A: Inversion is one type of chromosome aberration where the chromosome segment is excised and…

Q: B. Draw and discuss the life cycle of malarial parasites.

A: Malaria is a disease caused by a plasmodium parasite, transmitted by the bite of infected…

Q: Briefly describe two of the tree functions of RNA polymerase

A: RNA polymerase is an enzyme that is responsible for copying a DNA sequence into an RNA sequence,…

Q: Genetic resources Climate regulation Seed dispersal Aquaculture Recreation and ecotourism Air and…

A: Genetic resources - provisioning service Climate regulation - regulating service Seed dispersal -…

Q: A. Compare T. solium and T. saginata on the basis of - 1. Length 2. Scolex 3. Gravid segment 4. Egg…

A: Taeniasis is a kind of worm or parasitic infection that affects humans. This infection is caused by…

Q: 35. Which test tube contains the bacteria that strictly require a low oxygen concentration? O b. O…

A: Unicellular prokaryotic organisms, containing primitive nucleus, that can survive under all kinds of…

Q: Advantages of using the PCR include the following EXCEPT A it will always give the desired product…

A: Introduction PCR:- It is a technique to make many copies of a specific DNA region in vitro, It…

Q: Protein synthesis in bacterial cells usually starts with a: A methionine residue. B)…

A: ANSWER) (b) formylmethionine residue Formylmethionine residue is responsible for the protein…

Q: What kind of chromosomal mutations is/are produced by unequal crossing over?

A: Chromosome mutations are changes that arise in chromosomes as a result of nuclear division…

Q: E M F > D a. Draw the structure of the acentromeric chromosome using a line and letters to designate…

A: Inversion is one type of chromosome aberration where the chromosome segment is excised and…

Q: Next Which of the following is true about integral proteins according to the fluid mosaic model?…

A: According to the fluid mosaic model there are different types of proteins within the membrane.…

Q: 45 46 47

A: Photosynthesis is the process by which green plants synthesize their own food in the presence of…

Q: Which describes an enzymatic activity/biochemical function of importin-beta? facilitate release of…

A: Introduction : Importin beta are known as a type of karyopherin proteins which mediates the…

Q: What is Generation X?

A: Definition: -Generation X is defined as a collective term used to refer to all the Americans born in…

Q: a. What type of nucleic acid and from what species would the scientist use to begin construction of…

A: a. answer... the scientist uses chromosomal DNA to begin the construction of her genomic DNA…

Q: DNA replication involves a

A: DNA Replication: DNA is a self replicating material which carries the genetic information of the…

Q: 1. Describe the pathway of energy in light-dependent reactions. 2. Think of your own metaphor or…

A: The light-dependent reactions convert light energy into the energy storage molecule ATP and the…

Concept explainers

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.

Question

3b. An additional gene, called W, is found that affects the synthesis of enzymes 1 and 2. Mutant
d has a recessive mutation in gene W.
genotype
enzyme activity
without fictamine
1
with fictamine
2
strain
W
X
Y
Z
2
1
wild-type +
+
+
++
++
mutant a
+
+
+
mutant b
mutant c
+
++
mutant d
+
+
+
++
Once again, justify each answer in one sentence.
i) Is gene W most likely a positive or a negative regulator?
ii) Is the activity of W activated or inactivated by the presence of fictamine?
+
!
++
1
¦
:
:
#111
;
¦
++
:
++
++

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction: -

VIEW

Step 2 Explanation: -

VIEW

Step 3 Explanation: -

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following is not true of somatic cell gene therapy? a. White blood cells can be used. b. Somatic cells are cultured, and the desired DNA is introduced into them. c. Cells with the introduced DNA are returned to the body. d. The technique is still very experimental. e. The inserted genes are passed to the offspring.
1. Through observing the sequence of events (A → B → C → D) found below, describe how reproductive cloning is made possible. Your response should consist of 3—5 complete sentences. SENTENCE STARTER: The process of cloning may look quite tricky, but it can actually be broken down into 4 individual steps. In step A, the cells of the organism we want to be cloned are isolated and the… 2. What is an ADVANTAGE of engaging in cloning practices similar to the one highlighted above? What reason might a farmer, livestock owner, or someone else use as justification for cloning? 3. What is a DISADVANTAGE (or potential drawback) of cloning plants, livestock, or pets?
30. A. UDP- galactose-4 epimerase is lacking for patients with type 1 galactosemia B. Classic galactosemia is a mutation in chromosome 1p13 A. Statement A is correctB. Both statements are incorrectC. Statement B is correctD. Both statements are correct
1. Which of the following explains why prokaryotes have a bigger gene-to-genome size ratio compared to eukaryotes? A. Prokaryotic genome contains multiple promoters and repressors that control of a single gene.B. Prokaryotic genome is completely devoid of non-coding sequences.C. Prokaryotic genome contains multiple genes that are under the control of a common promoterand repressor.D. Prokaryotic genome contains one promoter region for each gene. 2. Which of the following can explain why eukaryotes have smaller gene-to-genome size ratio compared to prokaryotes?A. Genome size do not correlate with complexity in eukaryotes.B. The percentage of genes is inversely correlated with genome size in eukaryotes.C. Eukaryotic genome contains a lot of coding sequences.D. Eukaryotic genome contains a lot of non-coding sequences.
1) A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is copied or as the result of environmental factors. All BUT ONE of the statements below correctly describes or explains genetic mutations. A) Mutation can disrupt normal cell activity and cause diseases, like cancer. B) Mutations in parents' cells are then passed down to offspring via reproduction. C) Our cells can recognise any potentially mutation-causing damage and repair it before it permanent. D) Mutations can occur as the result of exposure to environmental factors such as smoking, toxins and radiation.
2)You would expect liver cells and muscle cells to have the same gene expression. a)True b)False
2) How does the HAEIII enzyme discriminate between the C-G polymorphism in the TAS2R38 gene?
5. Consider the following examples that include both haploids and partial diploids and explain in each scenario a. whether the repressor can bind and regulate expression and b. whether or not the lac operon is expressed. For partial diploids the plasmid is indicated by the F’. I + O +Z + Y + / F’ I+ O + Z + Y + I - O + Z + Y + / F’ I+ O + Z + Y + I - O + Z + Y + I + O c Z + Y +
Last week when I mutated the SSA1 gene in yeast it made cells grow faster, but made them sensitive to temperature. SSA1 can be said to display what? a. Antagonistic hypertrophy b. Agonistic pleiotropy c. Agonistic hypertrophy d. Antagonistic pleiotropy e. Reductive pleiotropy f. Modular pleiotropy
A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?
a. When gene probes, fi ngerprinting, and sequencing make it possible for you to know about genetic diseases in you or one of your children, would you wish to use this technology to fi nd out? b. What if it were used as a screen for employment or insurance? c. Most of us would agree to growth hormone therapy for a child with dwarfi sm, but how do we deal with parents who want to give growth hormones to their 8-year-old son so that he will be “better at sports”?
1. Describe which enzymes are required for lactose and tryptophan metabolism inbacteria when lactose and tryptophan, respectively, are (a) present and (b)absent. 2. Contrast positive versus negative regulation of gene expression. Describe therole of the repressor in an inducible system and in a repressible system.