Which describes an enzymatic activity/biochemical function of importin-beta? facilitate release of nuclear proteins after transport through the nuclear pore complex interact with/bind to nuclear localization sequences INLSS) interact with/bind to importin-alpha hydrolyze GTP to GDP + Pi

Which describes an enzymatic activity/biochemical function of importin-beta? facilitate release of nuclear proteins after transport through the nuclear pore complex interact with/bind to nuclear localization sequences INLSS) interact with/bind to importin-alpha hydrolyze GTP to GDP + Pi

Name: Which describes an enzymatic activity/biochemical function of importi
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which describes an enzymatic activity/biochemical function of importin-beta?facilitate release of nuclear proteins after transport through the nuclear pore complexinteract with/bind to nuclear localization sequences INLSS)interact with/bind to impor

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

What would most likely occur to nuclear-cytoplasmic shuttling if the intrinsic GTPase activity of RAN was slowed down by 50%? Group of answer choices RAN would not bind exportin and proteins would accumulate in the nucleus All of the answers are likely None of the answers are likely Importin beta would not release from RAN in the cytoplasm and nuclear import would slow down RAN would not bind to importin beta and protein cargo in the nucleus would not release
Explain the role/importance of the localization of GTPase-activating protein (Ran-GAP) in BOTH nuclear export and import. What would occur if there was a loss of function mutation in Ran-GAP? What would occur if Ran-GAP was localized in the nucleus?
Explain the mechanism by which the fungal toxin brefeldin A affects retrieval of KDEL-tagged proteins from the cis-Golgi network back to the endoplasmic reticulum.
Match the primary sequence to its characteristics/function/fate N-signal signal-anchor stop-anchor nuclear localization sequence KDEL 1. found at carboxyl terminus of ER resident proteins, interaction with its receptor directs retrieval from Golgi 2. hydrophobic, interacts with SRP and translocon, becomes transmembrane helix 3. mostly hydrophobic, interacts with SRP, cut off 4. hydrophobic, interacts with translocon, becomes transmembrane helix 5. basic, interacts with importin-alpha
Describe protein coat assembly• Describe the role of Coat Recruitment GTPases (include coat assembly and disassembly)• Describe the role of Rab GTPases
What is the role of the Ran-GAP protein in nuclear transport? Ran-GAP converts RanGTP to RanGDP Ran-GAP is a receptor on the nuclear membrane Ran-GAP is not directly involved in nuclear transport, it is a transcription factor Ran-GAP shuttles between mitochondria and the nucleus Ran-GAP converts RanGDP to RanGTP
Your roommate’s summer research project is to identify drugs that interfere with nuclear import. She identifies a drug that inhibits the ability of Ran to exchange GDP for GTP. What effect does this drug have on nuclear import? Describe where cargo protein Z would be found after it is synthesized in the cytosol.
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
The nuclear import of proteins larger than 40 kDa requires the presence of what amino acid sequence? Describe the mechanism of nuclear import. How are nuclear transport receptors able to get through the nuclear pore complex?
Which describes a cellular role of RanGEF? maintain Ran in the GTP bound form in the nucleus interact with importin-alpha stimulate/facilitate the inactivity of RAN provide the energy for the entry of the importins into the nucleus
Define SCF-proteasomedegrades phosphorylatedS phase CDK inhibitor
A protein complex in the nucleus is responsible for transporting mRNA molecules into the cytoplasm. Describe the proteins that form this exporter. What two protein groups are probably behind the mechanism involved in the directional movement of the mRNP and exporter into the cytosol?