Q: Fill in the blanks. It appears that this HeLa cell (look at picture) has _______ extra copies of…
A: HeLa cell line was the first immortal human cell line to be discovered. The cells were taken from…
Q: The chromosomes that do not affect gender (chromosomes 1 through 22) are called ________. Genetic…
A: Sex determining mechanism in case of human is XY type. Out of 23 paires of chromosomes present, 22…
Q: Describe the process of X-chromosome inactivation in mammals
A: X-chromosome inactivation, also known as lyonization, is a process by which one of the copies of the…
Q: A human cell that contains 22 pairs of autosomes (44), an X chromosome, and a Y chromosome could be…
A: Human beings have 46 chromosomes in the body cells. A male human has 22 pairs of chromosomes called…
Q: In mammals, sex is determined bya. the SRY gene on the Y chromosome.b. having two copies of the X…
A: In a biological system, the development of sexual characteristics in an organism determined by the…
Q: 23
A: This double stranded human DNA model was proposed by JAMES WATSON and FRANCIS CRICK. DNA consists of…
Q: Fill in the numbers: Humans = ____,_____. Fruit flies, who have 4 chromosomes and are diploid =
A:
Q: a micrograph of chromosomes from a normalhuman cell. If you created this kind of image using a cell…
A: The human has 23 pairs of chromosomes. There is one pair of sex chromosomes and 22 pairs of…
Q: All nucleated cells in the human body, except the reproductive cells, have ___________ pairs of…
A: The cells in the human body can be divided broadly into two categories: somatic and germ cells. Germ…
Q: Describe human diseases caused by changes in thenumber of sex chromosomes.
A: The sex chromosome in humans are X and Y where XX is for females and XY is for males. The disorders…
Q: Chromosomes which carry information that will determine the sex of an individual
A: Human beings have 23 pair of chromosome. Among this 22 pair of chromosome determine the various…
Q: A fertilized egg will develop into a boy if it receives a/n_____________chromosome from its father.
A: Ans: Fertilization: It is the process in which haploid gamets such as eggs and sperms are fused in…
Q: These all center on sex determination or the expression of genes encoded on sex chromosomes. Write a…
A: The chromosomes are the genetic material present in the nucleus of the cell which is a condensed…
Q: During X chromosome inactivation,______ . a. female cells shut down b. RNA sticks to a chromosome c.…
A: Answer is a.) female cells shut down.
Q: Which of the following is/are true about the chromosomes depicted in the picture? I. II. IV. Ea…
A: In genetics and genomics, crossing over refers to the exchange of DNA between homologous chromosomal…
Q: Part 1. Norrie disease is caused by a recessive mutation on the X chromosome in a gene called…
A: Answer :- The information about X chromosome- (B) The maternal chromosome is like imprinted in the…
Q: Lion has 38 chromosomes in total (2n = 38). During reproduction, the sperm of Lion will have _______…
A: The sexual mode of reproduction is the mode of reproduction in which gametes from different sexes…
Q: Cell growth in culture such as BHK21 divide by which process? meiosis binary fission…
A: Answer is option d.) mitosis.
Q: If an intestinal cell in a dog contains 78 chromosomes, a dog sperm cell would contain __________…
A: The karyotype is the number of chromosomes or the type of chromosomes present in the nucleus of a…
Q: Different versions of the same gene are called: Chromosomes O Alleles DNA O Daughter Cells
A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…
Q: Human cells have how many pairs of chromosomes (pairs, not total chromosomes)? 1) 46 2) 44 4
A: Mendel developed the idea of heredity in 1866, revealing that genes are present in the chromosomes…
Q: What shows a picture of all the chromosomes in a person's cell.
A: DNA is a very long molecule . it is located inside the nucleus and in a condensed form called…
Q: Fill in the blanks. It appears that this HeLa cell (look at picture) has __________ extra copies of…
A: Chromosomes are present inside the cell nucleus and made up of DNA (Deoxyribonucleic acid) molecules…
Q: Translocations ___________ Part of OneChromosome to Another Chromosome
A: Chromosomes are thread-like structures that are located in the nucleus. It is composed of protein…
Q: look for a phenotype, then [ Choose ] find the gene that was mutated several phenotypes all [ Choose…
A: Genetics involves the study of different genes and their inheritance pattern. In genetics, we can…
Q: How many pair of chromosomes in human body
A: A chromosome is a long DNA molecule that holds all or part of an organism's genetic information.…
Q: Why is X chromosome inactivation important in female cells? (300 word limit)
A:
Q: An error in meoisis that can result in someone getting the wrong number of copies of a chromosome is…
A: Meiosis is a cell division that causes the reduction of parental chromosomes into equal half and the…
Q: When DNA is copied, an identical strand of DNA forms and is called a A. sex chromosome B. histone C.…
A: In nucleus of a cell – DNA is present in form of chromosomes. These are compact structure of DNA…
Q: The Y chromosome in humans is found as a pair in males. the only human sex chromosome. present only…
A: The Y chromosome comprises over 59 million DNA building blocks (base pairs) and accounts for…
Q: Mutations in the ______________ chromosome can cause genetic disease.
A: Any alteration in the sequence of nucleotide of the genome is called mutation and these may result…
Q: if a cat has 38 chromosomes, how many chromosomes are in the following cells? a) hair b) claw c)…
A: Chromosome number usually refers to number of chromosomes present in diploid set i.e 2n. All the…
Q: Eukaryotic chromosomes a. have only histones b. have DNA and RNA c. have DNA, RNA, and protein d.…
A: There are different macromolecules present in the body. Carbohydrates, lipids, proteins, and nucleic…
Q: Find the correct order of the genes on the chromosome
A: In the given test cross progeny data table, first two highest frequency classes are the parental…
Q: Which of the following statements regarding the Y chromosome in mammals is TRUE? A. The Y chromosome…
A: Human cells have 23 pairs of chromosomes in which one set comes from the mother, while the other…
Q: HAPLOID CHROMOSOME A COMPLETE CHROMOSOME A DUPLICATE CHROMOSOME ONE-HALF OF THE REPLICATED…
A: The two chromatids of a duplicated chromosome are held together at a region of DNA called the…
Q: Gametes are made in the process of mitosis. are the result of replication. are the result of…
A: A gamete is a haploid cell (n) that fuses with another haploid cell during the fertilization in…
Q: What is the name of the event where homologous chromosomes find each other in order to line up their…
A: Introduction Cell cycle:- It is the process a cell goes through each time it divides which results…
Q: A killer whale (orca) cell has 22 pair of chromosomes in G1. What is the total number of chromosomes…
A: The answer is 22. Meiosis is a process during which cell chromosomes decreases.It a division…
Q: ........ chromosome are found in the body cell but not sex cells
A: The correct answer is - Homologous
Q: a chromosome can be sectioned into beads. what does each bead represent
A: A chromosome is a long DNA molecule with consists of a part or all of the genetic material of an…
Q: Gametes are produced by the process of mitosis meiosis crossing over replication
A: Gamete is a mature germ cell. Gametes combine to form a new organism. Male gametes are called…
Q: Make a sketch of the chromosome that is not found on you. Label the parts.
A: The proteins hold the DNA into a compact structure called chromosome. It is observed in the dividing…
Q: determine the order of the genes on the chromosome
A: This is the case of three point test cross. The progenies with greater numbers represent parental…
Q: A human somatic cell has autosome(s) and sex chromosomeſs). 44;2 2;44 22;1 1;22
A: Introduction :- Chromosomes are made up of DNA molecule and the proteins ( Histone proteins) that…
Q: The number of chromosomes found in the sperm cell of a mosquito is 3. Give the am of chromosomes to…
A: Mitosis: Equational division (2n => 2n) Meiosis: Reductional division (2n => n) Given:…
Q: А Female with a normal set of chromosomes В Female with an abnormal set of chromosomes C Male with a…
A: The picture is showing the karyotype of the female with an abnormal set of chromosomes. It is…
25)
Step by step
Solved in 2 steps
- A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying its segments, that would result from the following mutations. Q. Paracentric inversion that includes DEFGA chromosome initially has the following segments: A B • C D E F G Draw the chromosome, identifying its segments, that would result from each of the following mutations. a. Tandem duplication of DEF b. Displaced duplication of DEF c. Deletion of FG d. Paracentric inversion that includes DEFG e. Pericentric inversion of BCDEWhat types of chromosome mutations are required to change this chromosome into the following chromosomes? (In some cases, more than one chromosome mutation may be required.) Q. A B • C F E D G
- Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.In humans, chromosome 16 sometimes has a heavily stained area in the long arm near the centromere. This feature can be seen through the microscope but has no effect on the phenotype of the person carrying it. When such a “blob” exists on a particular copy of chromosome 16, it is a constant feature of that chromosome and is inherited. A couple conceived a child, but the fetus had multiple abnormalities and was miscarried. When the chromosomes of the fetus were studied, it was discovered that it had three copies of chromosome 16 (it was trisomic for chromosome 16), and that two of the three chromosome 16s had large blobs. Both chromosome 16 homologs in the mother lacked blobs, but the father was heterozygous for blobs. Which parent experienced nondisjunction, and in which meiotic division did it occur?A colleague e-mails you saying that she has identified an interesting chromosome variation at 21q13. In discussing this discovery with a friend who is not a cytogeneticist, explain how you would describe this location, defining each term in the chromosome address 21q13.
- A chromosomes structure can be altered by _______. a. deletions b. duplications c. translocations d. all of the aboveFor each of the terms in the left column, choose thebest matching phrase in the right column.a. reciprocal translocation 1. lacking one or morechromosomes or having oneor more extra chromosomesb. gynandromorph 2. movement of short DNAelementsc. pericentric 3. having more than two completesets of chromosomesd. paracentric 4. exact exchange of parts of twononhomologous chromosomese. euploids 5. excluding the centromeref. polyploidy 6. including the centromereg. transposition 7. having complete sets ofchromosomesh. aneuploids 8. mosaic combination of maleand female tissueWhat structures are found in a chromosome? Group of answer choices Two structures for the mitotic spindle to bind, and two complex repetitive structures that are maintained by telomerase One structure for the mitotic spindle to bind, and two complex repetitive structures that are maintained by telomerase One structure for the mitotic spindle to bind, and one complex repetitive structure that is maintained by telomerase Two structures for the mitotic spindle to bind, and one complex repetitive structure that is maintained by telomerase.
- A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying its segments, that would result from the following mutations. Q.Deletion of FGWhich types of mutations cause (1 word) a. Increase amount of genetic material in particular chromosome b increase amount of genetic material in all chromosomes c decreased amount of generic material in particular chromsomes d change to position of dna sequence in singular chromosome without changing the amount of genetic material e move dna from one chromosome to non homologous chromosomeAltered chromosome structure can drastically affect an individual organism’s phenotype. However, some types of chromosomal rearrangements are more likely to be harmful than others. Categorize the following types of rearrangements from MOST LIKELY to be harmful to LEAST LIKELY to be harmful. A. reciprocal translocation, deletion, translocation B. deletion, translocation, inversion C. inversion, translocation, reciprocal translocation D. translocation, inversion, duplication
