Q: Hazards consist of FIVE (5) major elements which are chemical, physical, biological, psychosocial…
A: There are various types of Hazards. Chemical, biological, physical, egronomical and psychosocial…
Q: A plant cell placed in a hypertonic solution will: O remain unchanged. O swell slightly. O undergo…
A: The three types of solutions that cause water to move in and out of the cell are- Hypotonic,…
Q: 4 Describe the Fluid Mosaic Model of the plasma membrane.
A: Introduction :- S.J. Singer and Garth L. Nicolson proposed the fluid mosaic model. This model…
Q: having
A: Biomolecules are the molecules that are involved in the maintenance and metabolic processes of…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: As per our Guidelines we are not allowed to answer more than three sub parts at a time.
Q: Icefish live in the extremely c They are the only vertebrates bin. They have a large heart a their…
A: A new study has discovered a concerning link between warmer seas, declining sea ice levels, and…
Q: Indicate whether each statement presents an idea of Jean-Baptiste Lamarck, of Charles Darwin, or of…
A: Lamarckism is the idea that an organism can transmit on physiological features gained by the parent…
Q: highly methylated DNA is active while less methylated DNA is inactive true or false
A: Statement is false. DNA methylation is basically the attachment of a methyl group to a nucleotide…
Q: Polygenic Inheritance: Cat Coat Color Read about the inheritance of cat coat color In each cat…
A: Given: X Gene is affected by coat color. Allele X^b - black fur. Allele X^B - orange fur. If it is…
Q: How can the efficiency of homologous recombination be improved when using CRISPR-Cas9, compared to…
A: CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) is a technique derived from…
Q: Target cells are: O Cells that send the signal O Cells that receive and respond to the signal Cells…
A: Introduction cell signaling or cell communication is the ability of a cell to receive, process, and…
Q: tion 4. Why nature derived carbons are good materials as com- pared to biochar? Write the main…
A: * Biochar is an carbon rich material which will produced during pyrolysis process which is a…
Q: Function of lysosomes
A: Lysosomes are tiny bodies with a single membrane covering them. It contains a variety of hydrolytic…
Q: The number of high energy molecules. / [ Choose ] arrangements (do not count ADP). The number of…
A: Metabolic cycle- are reactions that occurs in body to make products in smallest forms.
Q: Enzyme linked receptors: Function directly as enzymes or they are linked to enzymes O Are surface…
A: Enzyme linked receptors are also known as catalytic receptors, and it is a integral membrane protein…
Q: structures of organic compounds allow them to function as pigme
A:
Q: Which figure represent the lock and key model? Substrate Figure 1 Figure 1 Figure 2 Figure 3 Enzyme…
A: Introduction : lock and key model denoted the enzyme substrate interaction . Each Enzyme has a…
Q: during development, all cells have different genotypes and gene regulation allows different…
A: ANSWER;- true
Q: After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…
A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…
Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev
A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…
Q: What is sere?
A: Ecological succession: The mechanism whereby the mix of species and environment in a given area…
Q: A bird populations is surveyed for variation at four loci. The number of alleles per (1) locus is…
A: Percentage loci polymorphism It predicts the genetic diversity of a given population and can be…
Q: Which of the following farming approaches can grow food crops with lower negative impacts on the…
A: * Biodynamic farming is an alternative agriculture which takes an ecological and ethical approach to…
Q: Enzyme linked receptors: Function directly as enzymes or they are linked to enzymes O Are surface…
A: Enzymes are the biocatalyst that are responsible for enhancing the activation energy. These are…
Q: What is the purpose of the Map Kinase Cascade?
A: Cell signalling is a phenomenon of taking up information from the environment , and crosses through…
Q: Explain how GEF and GAP activate and deactivate RAS, respectively.
A: GEFs and GAPs are multidomain proteins that are regulated by extracellular signals and localized…
Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: 1. Methylation of DNA and acetylation of histones are inversely correlated. II. Methylation and…
A: The simplest physical as well functional component of heredity is the gene. DNA can be referred to…
Q: If Lamarck and Darwin had debated why giraffes have such long necks, how would their explanations…
A: Evolution is a steady ( gradual) phenomenon which cause transformation of life from simple to…
Q: B. Classify the flowers whether they are regular or irregular, complete or incomplete. Observe and…
A: The external morphology of plants helps in distinguishing them from other plants. The flowers of the…
Q: prit bris Smooth bori x beasd Wrinkled Smooth X Smooth Smooth Smooth Smooth Wrinkled 14. Based on…
A:
Q: Label the part of the male and female picture below:
A:
Q: The fact that a prokaryote has the ability to make a new protein that is placed in the cell membrane…
A: Prokaryotes are organisms in which cell do not have nucleus and organelles. Prokaryotes are further…
Q: Describe how you would go about step-wise using the biotechnology available (RNA sequencing, PCR,…
A: The most efficient strategy for disease prevention and control is vaccination, which involves the…
Q: Enzymes activity is the best at: O Optimal pH O Optimal temperature O Any condition O Optimal pH and…
A: Enzymes are biological catalysts that change the pace of chemical processes. Enzyme activity (the…
Q: Describe one successful accomplishment of the U.S. Endangered Species Act. Now describe one reason…
A: The Endangered Species Act restricts the import, export, or taking of threatened or endangered fish,…
Q: Explain and give insight why the use of a face shield protect us against COVID 19, and now it is no…
A: The face shield is a transparent kind of plastic and can be remolded to produce transparent glass…
Q: 3. The immune system immediately attacks a transplanted tissue or organ, so transplant recipients…
A: Introduction :- Transplant rejection occurs when the immune system of a transplant recipient attacks…
Q: About the process of industrial production of ethanol by the yeast Saccharomyces cerevisiae, mark…
A: The industrial production of ethanol is done anaerobically by yeast. During the fermentation process…
Q: Give three examples of each biotic interaction, specifically mutualism and predation. Please explain
A: Biotic interaction Biotic interaction is a kind of interaction where organisms living in same same…
Q: Did the five Big Extinction events in earth's history all occur due to the same environmental cause?
A: There have been five significant mass extinction events in Earth's 4.6 billion-year history, each…
Q: Give the names and the role of inhibitors of replication.
A: DNA replication It is a biological process that occurs in all living organisms and copies their…
Q: Put the following steps for the outline of the growth factor signaling pathway in order: Map Kinase…
A: Activities with constant changes in the environment. In doing so, organisms use a number of pathways…
Q: Which of the following is an INCORRECT statement? (Check all that apply) At Metaphase II, a human…
A: *mitosis is one of two type of cell division in which somatic diploid cells will be divided and…
Q: how the sequential opening and closing of voltage-gated sodium and potassium channels leads to…
A: Answer: sequential opening and closing of voltage gated sodium potassium channels leads to…
Q: What are the mechanisms by which viruses enter animal cells?
A: Introduction :- A virus is an infectious microbe made up of a nucleic acid segment (DNA or RNA)…
Q: 1.Which mechanism of evolution (selection, drift, mutation, non-random mating, or gene flow) do you…
A: Evolution is the process by which one species changes over time/generations in terms of various…
Q: What is the significance of hypothalamic and pituitary hormones in regulation of body metabolism and…
A: *Harmones are chemical messengers taht are secreted into blood and carries them to organs and…
Q: Given that COVID19 has a single strand RNA for its genome, the number of rounds required to complete…
A: COVID 19 is a SARS virus which causes epidemiological disease called corona virus.
Q: Calibri Light (H.. v 11 A BIU ov Av A 2. Are bacteria unit- or multicellular? What about the chains…
A: Since you've asked multiple questions, we are only answering the first three answers for you. If you…
Step by step
Solved in 2 steps
- According to the histone code hypothesis, the pattern of histone modifications acts like a language that a. influences chromatin structure. b. promotes transcriptional termination. c. inhibits the elongation of RNA polymerase. d. does all of the above.Centers of transcriptional repression that are usually associated with lamina or found around nucleolus are a) cajal bodies b) Barr bodies c) polycomb bodies d) None of these applyHistone deacetylase (HDAC) enzymes a.Promote initiation of translation. b.Complex with hyperphosphorylated pRb. c.Repress E2F family activity. d.Add acetyl groups to E2F promoters. e.Promote initiation of transcription.
- Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes (including many cancer-causing genes). Scientists determine that the histones from the cancer cells have an overall/average lower affinity for DNA than histones from normal control cells. Which drug is most likely to help treat this patient's cancer? a. An inhibitor for HMT (histone methyltransferases) b. An inhibitor for HDM (histone demethylases) c. An inhibitor for HDACs (histone deacetylases) d. An inhibitor for HATs (histone acetyltransferase)What are histone proteins, and how are their DNA binding properties regulated. Indicate if there are any modification(s) that comes on and off that regulates how tightly or loosely the Histone proteins are bound to DNA.1. Trithorax group proteins silence genes by* a. trimethylating histone 3 at lysine residue 2. b. trimethylating histone 4 at lysine residue 2. c. trimethylating histone 3 at lysine residue 4. d. trimethylating histone 4 at lysine residue 4. 2. Bonding of which ligand does NOT result to transcription activation?* a. fibroblast growth factor b. jagged protein c. TGF-β family d. Wnt family
- Chromatin remodeling is linked to epigenetics. Explain how this works and indicate the driving factors for this processThrough alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription of heterochromatin (c) produce related but different proteins in different tissues (d) amplify genes to meet the requirement of high levels of a gene product (e) bind transcription factors to enhancers to activate transcriptionA given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers provided
- Which of the following is true about chromodomains? a) bind methylated histone tails b) are associated with repression c) both a and b d) none of the aboveGive typing answer with explanation and conclusion Which of the following regions of DNA would you expect to be transcribed. Select all the apply. Marks removed for incorrect selection(s) O a. Enhancer O b. 3' UTR O c. 5' UTR O d. PromoterPossible genetic modifications that can cause epigenetic changes in gene expression include: A- all answers are correct B- histone acetylation C- chromatin remodeling D- histone variant localization  e- DNA methylation
