A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers provided

A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers provided

Name: A given section of DNA with the sequence TACACTGGTCAT is transcribed.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription?Group of answer choicesA: TACACTGGTCATB: ATGTGACCAGTAC: UACACUGGUCAUD: AUGUGACCAGUANone of the answers provided

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.
If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above
What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? 3’-CATCGGAATAGATCGCTAGTGGCAGGCATAATGATCACCGGTCTGAGAAAAGTGGTACATATCAAC-5’
A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct sequence of mRNA transcribed from this DNA template? ATGCGA UACGCU AUGCGA TACGCT
A piece of DNA reads ATGTTATAACCC. If this sequence is transcribed what will be the resulting mRNA sequence be?
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was transcribed? \ a. GAC TCA CGT b. GAG TAC GCC c. CGC ATG CGG d. GAC UCA CGU
What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
A gene includes the sequence AGAACT. When it is transcribed, what will the RNA sequence be? A. UCUUGA B. UGCCGU C. UCUUTC D. TCTTGA