Please answer fast True or False During transcription in prokaryotes, the initiation of transcript (RNA) polymerization occurs about 10 nucleotides upstream (-10, upstream) of the TATAAT sequence. explain please.

Please answer fast True or False During transcription in prokaryotes, the initiation of transcript (RNA) polymerization occurs about 10 nucleotides upstream (-10, upstream) of the TATAAT sequence. explain please.

Name: Please answer fastTrue or False During transcription in prokaryotes, t
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Please answer fastTrue or False During transcription in prokaryotes, the initiation of transcript (RNA) polymerization occurs about 10 nucleotides upstream (-10, upstream) of the TATAAT sequence. explain please.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

Mention two effects that phosphorylation of the CTD tail of RNA polymerase II has on the transcription process: Please answer asap and type your answer and answer should not be palgarised
Post-transcriptional Modification of Eukaryotic mRNAs What might be the advantages of capping, methylation, and polyadenylylation of eukaryotic mRNAs?
Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene THERE are multiple answer for this that I can choose Group of answer choices A 3' UTR B PPE sequences C 5' UTR D introns E core promoter F coding sequence G DNA-bending protein H enhancer sequence I mediator protein
Are the 5′ untranslated regions (5′ UTR) of eukaryotic mRNAs encoded by sequences in the promoter, exon, or intron of the gene? Explain your answer.
We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
34The crystal structure has been determined for the complete 12-subunit yeast RNA polymerase II bound to a transcription bubble and product RNA. Yesorno 35 ( ) can be used to purify transcription activator proteins 36A mutation that adds or deletes a base pair in the open reading frame and is termed a ( ) mutation.
In eukaryotes, transcription initiation involves enhancersequences located far from the promoter. In addition, thechromatin of eukaryotic chromosomes must be unwoundto allow access by _________?
Please answer only questions 5-10, thank you GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL…
Answer completely and correctly: Describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon.
Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesis