Answered: The crystal structure has been…

Name: 34The crystal structure has been determined for the complete 12-subuni
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 34The crystal structure has been determined for the complete 12-subunit yeast RNA polymerase II bound to a transcription bubble and product RNA.Yesorno35 ( ) can be used to purify transcription activator proteins36A mutation that adds or deletes a b

Science

Biology

The crystal structure has been determined for the complete 12-subunit yeast RNA polymerase II bound to a transcription bubble and product RNA. Yes or no

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
While helix-turn-helix (HTH) is known to be involved in both eukaryotic and prokaryotic transcription, helix-loop-helix (HLH) is mostly found in eukaryotes. Identify the differences between helix turn helix and helix loop helix.
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
EF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same effi ciency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.
88Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes ___________________ formation. A.pre-initiation complexb.TF recognition elementc.pre-elongation complexD.TATA binding complex 89Which of the following is the GDP-GTP exchange protein?A.EF-Tub.none of the abovec.EF-TsD.EF-G 90RNA polymerase II has 14 subunits. Yesorno
A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?
With several molecular biology techniques, researchers identified that the intertwined sequence could be naturally transcribed using a promoter located 13 kilobases upstream that of p16INK4A. In addition, the transcription of this gene results in a primary transcript that is read in a different reading frame and is alternatively spliced compared to the transcript of p16INK4A. The resulting protein has been called ARF (Alternative Reading Frame). In your own words and with a diagram, describe the DNA, RNA and proteins encoded in this region.
67RNA interference was first discovered in Drosophila melanogaster. Yesorno 68Which of the following is required for the bacterial ribosome complex to disassemble?A.EF1A-GTPb.Signal sequencec.Release factorD.EF1B 69A transcription unit must have an initiation signal called a _____________ for accurate and efficient transcription to take place. A.transcription start siteb.promoterc.transcription initiation factorD.ori
Transcription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?