Please help me answer this reviewer. Write the word TRUE if the statement is correct and if not, underline the word or statement that makes the sentence incorrect and write the correct answer on the space provided. 1. Gynogenesis is the process of animal development with exclusive paternal inheritance. Answer: 2. Cheese is a product of modern biotechnology.  Answer: 3. Green biotechnology is biotechnology applied to agricultural processes and products.  Answer: 4. Biotechnology refers to the direct manipulation of DNA to alter an organism’s characteristics (phenotype) in a particular way. Answer: 5. In the modern era, the term genetic engineering refers specifically to in vitro fertilization.  Answer:   Thank you very much for your help.

Q: Explain in 2-3 sentence about the advantage and disadvantage of using plastic in your everyday life.

A: Plastics are the synthetic polymers of carbon and other elements with high molecular weight . It is ...

Q: Heart beat activity

A: Heart normally beats in a regular rhythm.For an adult,the normal heart beat is 60-100 per minute.Hea...

Q: Which type of organism (obligate anaerobe, microaerophile, facultative anaerobe, aerotolerant anaero...

A: Introduction :- Obligate anaerobes are organisms that can only survive in oxygen-depleted situations...

Q: The koi (domesticated carp) in this example are one of 3 colors (solid orange, mottled white and ora...

A: Introduction :- Domesticated carps have recently been created in the majority of carp producing regi...

Q: What are some challenges still today about reproductive cloning

A:

Q: Why do we need to understand cell physiology in public health?

A: Public health is a science of preventing disease and improving the health qualities of communities v...

Q: Lactate is usually removed from the muscle cells by a(n) that also transports O antiporter, H* O ant...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: The Electron Transport System (ETS) The ETS must generate a hydrogen gradient (proton motive force) ...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: An ...

Q: You find a plant with four basic plant adaptations. Which adaptation would most direcly indicate tha...

A: Q.Chlorophytes and land plants have the following characteristics in common: Ans)both include specie...

Q: What mechanism of population level change requires sexual reproduction to operate? a. Gene flow b. M...

A: Sexual reproduction is a type of reproduction that comprises a complicated life cycle in which a sin...

Q: heart Love carries oxygenated blood from the lungs to the heart LOVU deoxygenated blood from the upp...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: Flg. 1. Breast cancer families 1 to 7. Solid circles, females with breast cancer; open circles, fe- ...

A: Answer:- An allele is the alternative and variant form of a gene, which is located on the same loc...

Q: Fill in the blank: The shape of a red blood cell is related to its function of

A: RBC is type of blood cell. 

Q: 1. Discuss how the transcending functions are associated with the integrative levels of organization...

A: Ecosystems are arranged to help researchers better understand the context in which they are being ex...

Q: Trivia about analogous structures

A: Analogous structures in evolutionary biology are biological structures with similar or corresponding...

Q: Please answer fast 1. Fertility can be compromised in women when their body mass index (BMI) falls ...

A: The prenatal development process is divided into three stages. The germinal stage lasts for the firs...

Q: Hypothesize  as to why iron can have an impact on bacterial growth, particularly S. Typhimurium, S.e...

A: INTRODUCTION Iron is an essential element for bacterial growth. Because it's participation in tricar...

Q: What is the advantages if using Kato-Katz method?

A: Kato-Katz method is a widely adopted method to prepare human stools for examination of the presence ...

Q: If a patient was bitten by a poisonous spider (black widow) and the effects of its venom occurred at...

A: The neurons are the smallest units of the nervous system. they are the nerve cells that are involved...

Q: What is the purpose of an autoclave and what is its mechanism?

A: Answer :- An autoclave is utilized in clinical and research facility settings to disinfect lab hardw...

Q: What is a test-cross? Why might a geneticist need to do a test-cross and how are the results used to...

A: A test cross is done to find out the genotype of the individual and whether it is homozygous or hete...

Q: Please choose all that apply for Phylum Arthropoda. segmentation coelom hemocoel O endoskeleton O op...

A: Introduction:- Animals without a notochord – the rod-like elastic structure that supports the body –...

Q: If the template DNA sequence is 3' - CCC - ATA - GAG - AAA - 5' , then what is the corresponding dau...

A: DNA is molecule which is present inside a cell and contain the genetic information of an individual ...

Q: What type of tissue is the heart made out of

A: Introduction:- Tissues are a collection of cells that have a similar structure and perform the same ...

Q: Why is it best to examine a freshly collected stool sample in clinical parasitology laboratory?   ...

A:   INTRODUCTION         In the  Medical Parasitology, the specimen collection is an important part th...

Q: Does the ATP synthase protein complex have to be located precisely on the membrane in relation to wh...

A: Plants and many other photosynthetic microorganisms use sunlight to generate food and energy.  This ...

Q: The Environment Act 2008 was repealed by the Environment Act 2002 True False

A: The Wild Life (Protection) Amendment Act, 2002 is an Act to provide for the protection of wild anima...

Q: What is the most likely order of the linked genes R, S, and T if the distance between R and S is 22 ...

A: The above scenario based on linkage and maping.

Q: In a short personal essay, what is the ultimate purpose of human life

A:

Q: Discuss the role of the regulator in relation with DNA damage and recombination in the article histo...

A: A histone is a protein that gives chromosomes structural support. Very long DNA molecules wrap aroun...

Q: How does the insect circulatory system carry out physiological insect defence mechanisms? Is there a...

A: The circulatory system present in insects differ from the circulatory system found in human body. An...

Q: Can colorless samples be analyzed using a UV-Vis spectrophotometer? Yes or No or Maybe?

A: UV-Vis Spectroscopy  It is defined as a quantitative technique that is used to identify the absorban...

Q: Multiple Alleles:

A: Given: Gene mutations may produce many different alleles of a gene. Some genes may have as many as 3...

Q: ch below with axygen level and function for each heart section. Function: Only identify where the bl...

A: Heart: it is an organ that pump the blood across the body via vascular system.  Vascular system: it ...

Q: How Small Noncoding RNAs Play Regulatory Roles in Bacteria ?

A: Small RNAs (sRNAs) influence gene expression via base pairing with mRNA after transcription. The int...

Q: Please answer fast The phenotypes of organisms are products of genetics, environment, and gene x en...

A: Phenotype: it represent the physical properties of organism that can be observed. Phenotype includes...

Q: When the relative abundance of an organism is used to determine the overall health of an environment...

A: Bioindicators are organisms, such as lichens, birds, and bacteria, that are used to monitor the heal...

Q: o you think multicellular fungi use diffusion, or use bulk flow, to transport O2 and CO2? Why do yo...

A:  The microscopic organisms that eats organic material are sometimes refers as the fungi. These are r...

Q: What is the purpose of examining a specimen slide containing a stool sample in a clinical parasitolo...

A: Stool is more than just a waste product. In primary care, some stool tests can be used to differenti...

Q: QUESTION 1 Vaccination increases the number of: different receptors that can recognize a pathogen ep...

A: The term vaccination is associated with the action responsible for stimulating the human body’s acti...

Q: QUESTION 3 Immunological memory explains which of the following? O The ability of a helper T cell to...

A: INTRODUCTION Immunological memory The immunological memory explains the ability of the immune system...

Q: How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside tr...

A:

Q: Which child is female 3 most likely an aunt of? O 1 O 2 3 4

A: DNA fingerprinting is a technology used to determine paternity, genetic relationships, and to solve ...

Q: Give a short description how two-point discrimination test is carried out in the lab.

A: Introduction:- The skin's two-point discrimination test is a simple sensory nerve function test. The...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: The den network of fibers that connect the two hemispheres is called the corpus Callosum. Much of wh...

A: The left and right hemispheres of the brain are symmetrical. The opposing side of the body is contro...

Q: When light hits the center of an ON-center receptive field, which of the following processes occur: ...

A: The following facts are required to be known to answer this question with logic:- Suppose there is  ...

Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe

A: Introduction  A chemical reaction is a process in which the reactants are converted into a product w...

Q: Thesis statement abut bioethtical issue of euthanasia.

A: The primary criteria for euthanasia was in terms of animal welfare. And that are that the method be ...

Q: Tay Sachs disease is a recessive lethal. Abnormally shortened fingers are the heterozygous form of ...

A: Alleles  are the alternative forms of a gene that are located on the same locus of homologous chromo...

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.