Which child is female 3 most likely an aunt of? O 1 O 2 3 4

Q: Please choose all that apply for Phylum Arthropoda. segmentation coelom hemocoel O endoskeleton O op...

A: Introduction:- Animals without a notochord – the rod-like elastic structure that supports the body –...

Q: Cross C: Homozygote wild type flies (+/+) were crossed with white eye flies. for the F1 and F2 gener...

A:

Q: Please help with the following prompt using as much details as possible. "One argument that is often...

A: Introduction  Life starts on earth around 3.4 billion years ago, in the ocean. The primitive organis...

Q: What is the advantages if using Kato-Katz method?

A: Kato-Katz method is a widely adopted method to prepare human stools for examination of the presence ...

Q: Albinism is a recessive disorder where there is a lack of melanin. Andrea and her husband Claude bot...

A: Given information Albinism is a recessive disorder.  Andrea and Claude both have normal skin pigmen...

Q: Which of the following joins Okazaki fragments by forming the last phosphodiester/ester bond during ...

A: DNA Replication is a process in which two identical copies of DNA are made  from the  parent DNA mol...

Q: What is an non pharmaceutical intervention for an flu outbreak in a community? And what questions co...

A: Based on limited data, the World Health Organization's recommended pandemic influenza interventions ...

Q: If 3 completely dominant gene pairs A a, B b, C c are assorting independently, how many progeny geno...

A: a. Progeny genotypes means the trait in daughter cell should contain all the alleles which are prese...

Q: PROBLEM The following data were obtained from the thyroid uptake study of a patient after administra...

A: thyroid uptake is the method via which the radiologist determines the thyroid function in the patien...

Q: A drug designed to inhibit the response of cells to testosterone would alme A. a decrease in recepto...

A:

Q: Describe an electrochemical sensor assay method for rapid bacterial detection and identification. Wh...

A: Electrochemical sensors work on the principle of sensing, recognition and production of electrical s...

Q: What section in the ribosome will the first anticodon enter? E site A site P site

A: There are specific  sites present in the ribosome  1) A site 2) p site 3,) E site

Q: Which of the following are used for mechanical digestion? A. Pancreatic juice B. Saliva C. Bile D. H...

A: Introduction:- The digestive system of the human body is made up of a collection of organs that work...

Q: How is a protein with a proper sequence generated?

A: Amino acids are biomolecules made up of two functional groups: an amino group (-NH2) and a carboxyl ...

Q: Does the type of the diet of the insect affect the structure of organs/parts of the digestive system...

A: Insects eat by grinding, sucking, lapping, and chewing. Crops are being created in the esophageal ar...

Q: What is the purpose of the Kreb's Bicycle in nitrogen metabolism? Include in your description where ...

A: Introduction: The reactions which help in converting pyruvic acid to carbon dioxide and water in mit...

Q: How could you describe the process shown below? Farming reduces forest area Deforestation reduces ra...

A: By examining the above process it can be concluded that the terms Diverging process and Neutral proc...

Q: Phosphate head of phospholipid bilayer is hydrophobic in nature. True False

A: Since you have asked multiple questions , we will solve the first question for you. If you want any ...

Q: You are a genetic counselor, and you received the following pedigree to analyze. You must determine ...

A: Generation 3 is.... 1. Dd 2, 3,4,5,6.. is dd Genotype.  

Q: Pancreatic juices, saliva, and bile are used only for mechanical digestion? A. True B. False

A: Mechanical digestion comprises physically breaking down food items into smaller chunks in order for ...

Q: While investigating the function of a specific growth factor receptor gene from humans, researchers ...

A: Growth factors work by engaging with certain cell surface receptors to control cellular proliferatio...

Q: Why doesn’t the father (II-1) have the disease breast cancer? What is the formal name for an indivi...

A: 1) The pattern of inheritance of the pedigree is autosomal recessive. The father (I-1) is heterozygo...

Q: How many bones in the human body

A: Bones provide structural support and rigidity to different organs of the body. They form attachment ...

Q: Mega- gametophyte L H. M K G E B. A,

A: Plant Kingdom is a kingdom which consists of autotrophic , photosynthetic organisms that is plants. ...

Q: explain  the scope of practice for EMTs in arizona.  Is the scope of practice dictated by the state ...

A: Scope of Emergency medical technician is good in Arizona.  Avg salary per hour for emt in arizone is...

Q: If stroke volume is 0.1 liters and heart rate is 100 beats per min, what is cardiac output? Group of...

A: Cardiac output (CO) is the measure of how much blood your heart pumps each minute. It is calculated ...

Q: The cell membrane is made up of many diferent kinds of proteins. These proteins can be clasited as e...

A: The cell membrane mainly consists three types of proteins in it. Those are (1) Peripheral protein ;(...

Q: he daughter can be considered an expert witness in a scenario like this because she has knowledge, e...

A: There are few point about expert witness: As we know that now a days expert witness are very importa...

Q: The Electron Transport System (ETS) The ETS must generate a hydrogen gradient (proton motive force) ...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: An ...

Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a pr...

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying e...

Q: Which type of organism (obligate anaerobe, microaerophile, facultative anaerobe, aerotolerant anaero...

A: Introduction :- Obligate anaerobes are organisms that can only survive in oxygen-depleted situations...

Q: 4. You have determined that the gene order for three linked genes being studied is A B C. The number...

A: The frequency of recombination is a metric of genetic linkage that is used to create a genetic linka...

Q: 1. In a three-point testcross, the nonrecombinant progeny are A* B* C* and a b c. The double- crosso...

A: Q. In a three-point testcross the nonrecombinant progeny are A+B+ C+ and a b c. The double crossover...

Q: Enumerate clinically relevant parasites that can be visualized using the Kato-Katz method in a clini...

A: The most prevalent method of gastrointestinal infection is the contamination of water, food, and han...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: Illustrate the principles involved in riboswitch control. ?

A: Introduction: In the early 2000s, a new gene regulatory mechanism was uncovered in bacteria. The pro...

Q: The _ stores bile, while the _ secretes digestive enzymes, and the _ is the largest visceral organ?

A: Q. The _ stores bile, while the _ secretes digestive enzymes, and the _ is the largest visceral orga...

Q: How will you distinguish b Stem cell from B cell at DNA level

A: B stem cells: it includes pluripotent hematopoietic stem cells that gives rise to multipotent common...

Q: When does chromosomal nuclear DNA, which is found inside the nucleus of a eukaryotic cell, replicate...

A: The cell division involves production of new daughter cells from the mother cell. Different strategi...

Q: What are the functions of the cardiovascular system?

A: The cardiovascular system consists of the heart, blood vessels, and blood. Its primary function is t...

Q: In a nursery, four babies had their id bracelets accidentally removed. The blood group from each bab...

A: The "ABO" blood group system is made up of four blood groups – A, B, AB, and O and is based mostly o...

Q: The creation of the Covid 19 vaccine is said to build the body's immune system or defense mechanism ...

A: Different types of vaccines provide protection in different ways. However, all vaccines leave the bo...

Q: autoimmune diseases?

A: Autoimmune disease : A disease in which the body's immune system attacks healthy cells.

Q: Please answer fast 1. Fertility can be compromised in women when their body mass index (BMI) falls ...

A: The prenatal development process is divided into three stages. The germinal stage lasts for the firs...

Q: List out Bone loading bearing's material properties (in bullet point) Explain each!

A: Bone loading : The tibias found in the lower leg below the knees are weight bearing bones . It is on...

Q: _______is life’s primary source of energy. a. Food b. Water c. Sunlight d. ATP

A: Food is essential for humans and other animals because it provides the energy needed to perform ever...

Q: In cyclic photophosphorylation, an electron in P700 is excited by a photon and begins to taking the ...

A: The light reaction of photosynthesis involves production of ATP and NADPH by using sunlight. In this...

Q: Describe phosphorylation and give an example

A: Phosphorylation is classified as a biochemical process. This biochemical process comprises attachmen...

Q: A 25-year-old woman presents to the physician with a complaint of several episodes of headaches in t...

A: Henry Parinaud was the ophthalmologist that first described the eye movement disorder and he was the...

Q: Problem 3. In a population of cattle, the frequency of allele R is .7 and of allele r is .3. Also, t...

A:  Frequency change due to mutation in different generation: Rt=R(1-m)t Rt=change in allele frequency ...