Point mutations affect. can be classified by Answer 1 Answer 2 Answer 8 in which nucleotide base pairs may be such as- Answer 3 Answer 4 Answer 5 Answer 9 Missense mutations Answer 10 known as known as known as in which there is in which there is in which there is No change in amino acid sequence Premature termination of polypeptide Answer 6 Deletion mutation Answer 7 Answer 11 may résult in- Frameshift

Point mutations affect. can be classified by Answer 1 Answer 2 Answer 8 in which nucleotide base pairs may be such as- Answer 3 Answer 4 Answer 5 Answer 9 Missense mutations Answer 10 known as known as known as in which there is in which there is in which there is No change in amino acid sequence Premature termination of polypeptide Answer 6 Deletion mutation Answer 7 Answer 11 may résult in- Frameshift

Name: 100%Point mutationsaffect.can be classified byAnswer 1Answer 2Answer
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 100%Point mutationsaffect.can be classified byAnswer 1Answer 2Answer 8in which nucleotide base pars may besuch as.310Answer 3Answer 4Answer 5Answer 9Missense mutationsAnswer 10known asknown asknown asIn which there isin which there isIn which there

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter3: The Chemistry Of Life: Organic Compounds

Section3.5: Nucleic Acids

Problem 1C: VISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label...

See similar textbooks

Similar questions

1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
A genetics student was asked to draw the chemical structureof an adenine- and thymine-containing dinucleotide derivedfrom DNA. His answer is shown below. The student made morethan six major errors. One of them is circled, numbered 1, andexplained. Find five others. Circle them, number them 2 to 6, andbriefly explain each by following the attached given.
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?
May you please help me with this? A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An aliquot was removed from the reaction mixture every minute for 5 minutes and the A260 recorded. The following data were obtained. Time (min) A260 0 0.60 1 0.64 2 0.67 3 0.70 4 0.72 5 0.73 Describe the action of deoxyribonuclease on DNA and explain the increase in A260.
Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.
INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
Describe why this position in your protein is important and outline the effects the mutation will have on the 3D structure and the function of your protein. (up to 50 words) My PDB code: 3GRS Residue point: HIS 467 Mutation: LEU 467
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?