Which type of mutations are the least harmful to an organism? *O DuplicationO SubstitutionO InsertionDeletion9 This is a required questionWhich of the following statements about mutations are true?Mutations are abwave nassed down to future generations

Name: Which type of mutations are the least harmful to an organism? *O Dupl
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Which type of mutations are the least harmful to an organism? *O DuplicationO SubstitutionO InsertionDeletion9 This is a required questionWhich of the following statements about mutations are true?Mutations are abwave nassed down to future generatio

Mutations are sudden changes in the DNA sequence and lead to several new characteristics in an…

Answered: Which type of mutations are the least…

Science

Biology

Which type of mutations are the least harmful to an organism? * O Duplication Substitution O Insertion Deletion

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

Our bodies are not defenseless against mutagens that alter our genomic DNA sequences. What mechanisms are used to repair DNA?
A gene mutation changes an AT base pair to GC. This changecauses a gene to encode a truncated protein that is nonfunctional.An organism that carries this mutation cannot survive at high temperatures.Make a list of all the genetic terms that could be used todescribe this type of mutation.
A protein was mutated at amino acid position 129. Which of the following mutations will least effect the protein's function? a.) R mutated to K b.) R mutated to L c.) R mutated to A d.) R mutated to D
Plsssss helppppp What exactly are mutations? Can mutations have helpful effects, harmful effects or no effects at all?
Which of the following types of mutations is represented in Table 1? a.) Insertions b.)Deletions c.) Point mutation d.) Transversion e.) Transition
Point mutations arise more commonly than other types of mutations. -True or False
What type of mutation can we get if we use phones and laptops too much
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
A gene mutation changes a base pair from AT to GC. This change causes a gene to encode a truncated protein that is nonfunctional. An organism that carries this mutation cannot survive at high temperatures. Make a list of all the genetic terms that could be used to describe this type of mutation.
An alien visits Earth and is found to have the same 'genetic code' as humans. However, the alien has many more 'stop' codom which replace codoes that are redandant in the human genetic code. If nucleotide substitution errors occur at the same rate for aliens and humans, the aliens would have many more of whichkind of mutations?a.) missense mutation only b.) silent mutations only c.) nonsense mutations only d.) antisense mutations only e.) silent and missence mutations
A SNV mutation that results in an early stop codon is called: A. silent mutation B. silencing mutation C. missense mutation D. nonsense mutation E. frameshift mutation
In humans, sickle-cell anemia and hemophilia represent which type of mutations? Loss of function mutation Gain of function mutation Behavioral Mutation Biochemical mutation