Answered: Silent mutation: Single substitution…

Name: BMD 101: Biochemistr ...Silent mutation: Single substitution mutation
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: BMD 101: Biochemistr ...Silent mutation: Single substitution mutation when the change in the DNA base sequence results in a new codon still coding for the same amino acidSelect one:O TrueO FalsegeOUS ACTIVITYRNA LectureJump to..

Science

Biochemistry

Silent mutation: Single substitution mutation when the change in the DNA base sequence results in a new codon still coding for the same amino acid Select one: O True O False

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 28CTQ: Explain how single nucleotide changes can have vastly different effects on protein function.

See similar textbooks

Similar questions

Which of the following is not made out of RNA? the carriers that shuffle amino acids to a growing polypeptide strand the ribosome the messenger molecule that provides the code for protein synthesis the intron
Discuss how enzymes proofread and repair errors in DNA.
Which of the following phases is characterized by preparation for DNA synthesis? G0 G1 G2 S
3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence transcribed from template?Amino acid sequence of peptide?and Type of mutation?
DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?
5 difference between spontaneous and induced mutations give examples for each
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… a)Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strand.
4. Indicate whether each of the following words orphrases applies to proteins, DNA, or both.a. a macromolecule composed of a string of subunitsb. double-strandedc. four different subunitsd. 20 different subunitse. composed of amino acidsf. composed of nucleotidesg. contains a code used to generate othermacromoleculesh. performs chemical reactions
The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence of the DNA coding strand? Of the DNA template strand?
Please explain it simply, and don't over-explain. Thanks! A. How can DNA be used to pass on inheritable material & make proteins?
https://cancer.sanger.ac.uk/cosmic/gene/analysis?ln=TP73 using the above linke, Briefly describe the most common mutation found in this gene. Include details about the type of mutation, and the predicted effect. . where does the mutation occur, what bases are changed; does the mutation change the protein sequence, and if so what would the likely biologics consequences be?
B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been changed