Protein ClassificationA protein is given for each item. Each protein is to be classified based on the required basis of classification. Choose one specific classification for each item.Choices:FibrousGlobularSimpleConjugatedStorageTransportNutrientDefenseRegulatoryStructuralCatalyticMotility SMART VOLTEallSOS onlyO N 88I 12:27SSTubulin astochemicalnatureVitellineas toshapeLectin asto shapeHDL as tofunctionIgE as tofunctionIgE as tochemicalnatureProteaseas tofunctionGlucagonas tofunctionMyoglobinas tochemicalnatureElastin asto nature( SMART VOLTESSO N 88I 12:28SOS onlyGlutelin asto natureOvalbuminas tonatureChromatinas tonatureHDL as tochemicalnatureOvalbuminas toshapeTubulin asto shapeVitellineas tonatureProteaseas toshapeGlucagonas toshapeElastin asfunction

Here in this question protein classification is asked so it's important to know that proteins are…

Protein Classification A protein is given for each item. Each protein is to be classified based on the required basis of classification. Choose one specific classification for each item. Choices: Fibrous Globular Simple Conjugated Storage Transport Nutrient Defense Regulatory Structural Catalytic Motility

Protein Classification A protein is given for each item. Each protein is to be classified based on the required basis of classification. Choose one specific classification for each item. Choices: Fibrous Globular Simple Conjugated Storage Transport Nutrient Defense Regulatory Structural Catalytic Motility

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter4: Cell Structure

Section: Chapter Questions

Problem 43CTQ: Pathogenic E. coil have recently been shown to degrade tight junction proteins during infection. How...

See similar textbooks

Similar questions

Ese biochemistry me Krna post
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Thesecondarystructureofaproteinisinfluencedbybothhydrogen bonding and London dispersion forces. a. Usingastructuralformula,showanexampleofhydrogenbonding between the serine portion of a protein and the tyrosine portion b. Usingastructuralformula,showanexampleofLondondispersionforces between the leucine portion of a protein and the valine portion
9. Many protein modifications take place in the endoplasmic reticulum (ER). Name one ER enzyme (and state its role) that functions to modify a protein.
The goal of structural proteomics project isa) To crystallize and determine the structure of as many proteins as possible, in many cases with little or no existing information about protein functionb) To identify and sequence of all the genes present in the human bodyc) To introduce new genes to human beingsd) To remove disease causing genes from humans
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… d) Assuming the sequence above is a bacterial gene, identify the region encoding the Shine-Dalgarno sequence. e) What is the function of the shine Dalgarno sequence?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified protein.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… c) Give the polypeptide sequence, and identify the N-terminus and C-terminus.
The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…
Pathogenic E. coil have recently been shown to degrade tight junction proteins during infection. How would this provide an advantage to the bacteria?
Contrast transcription and translation. Name at least three differences between the two processes.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… a)Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strand.