Question
Asked Oct 17, 2019
38 views

30  A DNA sequence encoding a five-amino acid polypeptide is given below.

…ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…

…TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA…

c) Give the polypeptide sequence, and identify the N-terminus and C-terminus.

check_circle

Expert Answer

Step 1

Protein molecules are those molecules that are made up of chains amino acids in a specific order. This chain is known as an amino acid or polypeptide sequence. For the formation of proteins, body undergoes a series of protein synthesis.

Step 2

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT –Template strand.

Although, in this strand ATG (AUG in mRNA) is present. But it has a TAA codon which is UAA (in mRNA). It is a stop codon.

So, the other following strand is the coding strand.

 

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA---Coding strand.

 

The coding sequence would be - ATGGTACGGTCTGAT

It has a stop codon TAG.

Step 3

The mRNA sequence and its polarity is as follows:

5' AUGGUACGGUCUGAU 3'

Thus, the five amino acid sequence are –

Methionine -Valine –Arginine- Serine-Aspartic acid

 

Because...

Want to see the full answer?

See Solution

Check out a sample Q&A here.

Want to see this answer and more?

Solutions are written by subject experts who are available 24/7. Questions are typically answered within 1 hour.*

See Solution
*Response times may vary by subject and question.
Tagged in

Science

Biology

Related Biology Q&A

Find answers to questions asked by student like you

Show more Q&A add
question_answer

Q: A bacterium of genotype a+b+c+d+ is the donor in a cotransformation mapping. The recipient is a–b–c–...

A: Transformation is a natural process of uptake of DNA (deoxyribonucleic acid) by a bacterial cell fro...

question_answer

Q: what enzyme is responsible for making mrna in a cell

A: The messenger RNA or mRNA is a nucleic acid molecule that conveys the genetic information from the D...

question_answer

Q: What are the 3 types of connective tissue?  Give the function of each type and the subtypes of each.

A: Connective tissue is one of the four basic types of animal tissues found in the animal system, along...

question_answer

Q: Two genes, A and X, exhibit incomplete linkage. The frequency of the parental gametes (AX and ax) is...

A: When genes exhibiting different traits are located on the same chromosomes they are said to be linke...

question_answer

Q: Electrical gradients ( potential; charges) exists on cell membranes because in part when the cell is...

A: Membrane potential is the difference in the electric potential (gradient of ion concentrations) acro...

question_answer

Q: Explain how the hoghly ordered structure of a cell does not conflict with the second law of thermody...

A: The second law of thermodynamics states that the entropy of an isolated system can never decrease ov...

question_answer

Q: A Canadian population of Ross’s geese, small Arctic nesting geese, has 10,000 individuals.  Ross’s g...

A: The population is in Hardy-Weinberg Equilibrium; hence the phenotypic frequencies can be calculated ...

question_answer

Q: What type of nuclear reaction does a CAT scan use? a. Gamma Emission b. Electron Capture c. Beta Dec...

A: CAT scan is also known as CT (computer tomography) scan is the process of viewing the cross-section ...

question_answer

Q: Biologists use the fluid mosaic model to descfibe membrane structure. Which statements about the flu...

A: The structure of the functional cell membrane is explained by Singer and Nicolson’s mosaic model. Ac...