Put Koch’s postulates in order.(a) The disease organism must be isolated in pure culture.(b) The disease organism must be recovered from the in-oculated animal.(c) The specific causative agent must be found in every caseof the disease.(d) Inoculation of a sample of the culture into a healthy, sus-ceptible animal must produce the same disease.

Q: The intracellular matrix differs from the extracellular matrix in that the latter is located A…

A: Q. The intracellular matrix differs from the extracellular matrix in that the latter is located A…

Q: What are the characteristics common to all arthropods? List all of them.

A: Invertebrates are the organism belonging to animal kingdom which do not possess backbone . Such…

Q: 1. Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…

A: Test cross is a cross between F1 individual and recessive individual. By crossing the F1 individual…

Q: What would be the working stock concentration (in molarity) if you diluted 250 uL of a stock…

A: Molarity is defined as the number of moles dissolves in 1000 ml of the solution.

Q: SHORT ESSAY. Answer the following questions briefly. Write your answers on the space provided. Limit…

A: INTRODUCTION Thermoregulation This is the process by which mammals maintain their body temperature.

Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W)  will create offspring…

A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…

Q: While you were driving to San Francisco, you saw many billboards on the highway but you could not…

A: The smallest level of stimulation that may be recognised is known as an absolute threshold, which is…

Q: 1. Along the coast of Vancouver Island in British Columbia, Canada consists of intertidal zones…

A: Introduction  The term "population" usually refers to the number of people living in a specific…

Q: chromosomes will there be in the cells at the When, during the life of an organism, would you expect…

A:

Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: Supported lipid bilayers (SLBs) are widely used in biophysical research to investigate the effect of…

A: Supported lipid bilayer or SLB is the artificial platform based on solid surface, that can mimic the…

Q: SEQUENCING: Arrange thes systems of animals. Assign nur your notebook. 10. receptor potentia 11.…

A: Reflex arc  Pathway along which nerve impulses travels during the reflex action.

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…

A: Antibodies are the proteinaceous substances which are produced by the B cells of the immune system.

Q: Explain the process of seed development in a typical angiosperm plant. 2. Describe the two -stage…

A: Angiosperms are flower-bearing plants and are the most diverse group of terrestrial plants. The…

Q: What is the advantage, if any, of direct development in gnathostomulids? 2. What are the…

A: Gnathostomulids is the marine worm while rotifers are multicellular organism.

Q: Endosymbiosis states that free-living [ ? ] were engulfed J of and became the [ ]of the eukaryotes…

A: Introduction :- Endosymbiosis occurs when one cell engulfs another, resulting in a coevolved…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A:

Q: Which of the following structures are involved in balance/equilibrium? Select all that apply.…

A: A. Cerebellum controls posture and balance.  Semicircular canal, Vestibule and cochlea are part of…

Q: QUESTION 4 In fruit flies, white eyes (we) and miniature wings (mw) are encoded by two mutant…

A: The test cross is given in this question. The crossing occurs between the unknown parent with…

Q: QUESTION 3 You are a clinical geneticist who is evaluating a newborn female child with a congenital…

A: The female child has two X chromosomes and 44 Autosomes.  The number of barr body is determined by…

Q: Which statement of the cell theory is connected to an understanding of meiosis? Cells are the basic…

A: Cell is the basic structural and functional unit of the organ of human , they have their own ability…

Q: escribe the behavior and neural mechanisms involved luring cricket communication used for…

A: Crickets are nocturnal, so they chirp at night. Male chirp to attract the female for mating.       “…

Q: 2. The endosperm of maize can either be yellow of White. with two alleles, Y has yellow endosperm…

A: INTRODUCTION The endosperm is the tissue that surrounds and nourishes the embryo in angiosperm seeds…

Q: 21. Which of the following species, either presently or formerly listed as endangered or threatened,…

A: Otters rarely attack humans, but can sometimes be territorial, especially when they are protecting…

Q: Mike is a 34-year old male who reports to the ER after a motorcycle accident. MRI results show that…

A: In a person that has transected spinal cord injury between T1 and L1, it would have paraplegia.

Q: 32. Operons are the basic units by which transcriptional regulation occurs in prokaryotes. Using…

A: Genes coding for functionally related proteins are concentrated throughout the DNA of bacteria and…

Q: Albinism is homozygous recessive (aa). A sister with normal coloration has a sister that has…

A: Albinism is a disorder of autosomal recessive inheritance.  Albinism inhibits melanin production,…

Q: Which statement of the cell theory is connected to an understanding of meiosis? Cells are the basic…

A:

Q: Question How does the female reproductive system protect itself from pathogens?

A: Pathogen  It is defined as the organism that have the ability to cause a disease. The microbes cause…

Q: What are some changes in the brain that occur in someone with major depression? Describe both…

A: In several cases, the person under depression found to have shrinked brain. The gray matter volume…

Q: Explain auxin’s effect on growth and how it causes plant cellsto enlarge.

A: Plants naturally produce auxins, a potent growth hormone. They promote cell division, stem and root…

Q: 1. The rubella virus causes German measles. If a pregnant woman is is infected by the rubella virus…

A: Introduction  Rubella, often known as German measles or three-day measles, is an infectious disease…

Q: In this scenario, we'll be discussing the Xtina gene, which encodes the Xtina protein. Xtina is…

A:

Q: Insulin is produced using O Aspergillus O Golden rice Corn Safflower

A: Insulin is a peptide hormone secreted by beta cells in the pancreatic islets and is the body's…

Q: The enzyme armylase digests.

A: Amylase is an enzyme made up of protein. It is specific with its substrate and its substrate is…

Q: Give an example of a physiological adaptation using organs and/or tissues of an organism of your…

A: A metabolic or physiologic adjustment within an organism's cell or tissues in response to an…

Q: What is the frequency of alleles in this population? a) CB (p)= 0.2 CG (q)= 0.8 b) CB (p)= 0.3 CG…

A: In the question, a picture is given that is the representation of a population where the green…

Q: Which of the following is NOT a catalytic strategy used by trypsin? a. Acid-base catalysis b.…

A: Enzymes require an ideal pH range and temperature to operate properly. The tertiary structure of the…

Q: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…

A: Question - What is biology?   A) The study of DNA. B) The study of the environment. C) The study of…

Q: ANSWER THESE QUESTION; Click Edit DNA and make a substitution mutation that changes the first base…

A: Original sequence- ATG CCA GGC GGC GAG AGC TTG CTA ATT GGC TTA TAG Edited sequence- changes the…

Q: 2. Consider genes that have 2 alleles each. Gene 1 has allele "E" and "e", where E is dominant to e.…

A: A dihybrid test cross is a cross between a double heterozygous individual and a double homozygous…

Q: If the molecular weight of E.coli DNA is taken as 2.7x10 and the average molecular weight of any…

A: Note: The Values given in the question may be different as in original question, but concept is…

Q: Biology is it true that the link caloric effect and cancer is that as calories rise the cancer…

A: Cancer is a broad term that describes a variety of disorders characterised by the uncontrollable…

Q: The probability of having an individual with a least a heterozygous gene pair on its genotype from…

A: The two genes are involved in this case. That's why it is a case of dihybrid cross.

Q: Question - How does the female reproductive system protect itself from pathogens?

A: Female reproductive system is highly protected from pathogen invasion,

Q: Direction: With the use of Venn Diagram, compare and contrast the plant and animal reproduction…

A: Van digram use to construct to show difference and similarities between two individuals .

Q: Answer the following questions in paragraph form consist of at least five sentences. 1. Explain…

A: The human body consists of billions of smaller components divided into four categories: cells,…

Q: song an When researchers gave pair-bondec amine in their drinking water, the u oxytocin. What effect…

A: The prairie vole animals have been studied for doing research in oxytocin animals .this is because…

Q: Based on the milkfish dissection, describe the structure of skull and vertebral column design. How…

A: Answer :: Milkfish (Chanos chanos) is the only fish species that belongs to Family Chanidae which is…